Incidental Mutation 'R6161:Masp2'
ID489861
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Namemannan-binding lectin serine peptidase 2
SynonymsMASP-2, MAp19
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148602554-148615499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148614012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 517 (I517F)
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045180] [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000095719] [ENSMUST00000105699] [ENSMUST00000105700] [ENSMUST00000105702] [ENSMUST00000140897] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000186729] [ENSMUST00000186711] [ENSMUST00000187939] [ENSMUST00000190696] [ENSMUST00000186947] [ENSMUST00000189048] [ENSMUST00000188134] [ENSMUST00000190552] [ENSMUST00000191450]
Predicted Effect probably benign
Transcript: ENSMUST00000045180
SMART Domains Protein: ENSMUSP00000038113
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052060
AA Change: I517F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: I517F

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095719
SMART Domains Protein: ENSMUSP00000093386
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105699
SMART Domains Protein: ENSMUSP00000101324
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105700
SMART Domains Protein: ENSMUSP00000101325
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140897
SMART Domains Protein: ENSMUSP00000135135
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 1 28 2e-13 BLAST
RRM 44 110 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154898
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189041
Predicted Effect probably benign
Transcript: ENSMUST00000190630
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191378
Predicted Effect probably benign
Transcript: ENSMUST00000186711
Predicted Effect probably benign
Transcript: ENSMUST00000187939
SMART Domains Protein: ENSMUSP00000140928
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 18 84 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Predicted Effect probably benign
Transcript: ENSMUST00000190287
Predicted Effect probably benign
Transcript: ENSMUST00000190696
SMART Domains Protein: ENSMUSP00000139637
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 55 79 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000186947
SMART Domains Protein: ENSMUSP00000140529
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
low complexity region 215 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189048
SMART Domains Protein: ENSMUSP00000140364
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190552
SMART Domains Protein: ENSMUSP00000141052
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM_2 1 56 6.1e-4 SMART
RRM 72 138 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191450
SMART Domains Protein: ENSMUSP00000140832
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
RRM 192 258 3e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148602729 missense probably benign 0.05
IGL01284:Masp2 APN 4 148614007 missense probably damaging 1.00
IGL02040:Masp2 APN 4 148603813 missense probably damaging 1.00
IGL02243:Masp2 APN 4 148603068 missense probably benign 0.32
IGL02490:Masp2 APN 4 148607943 missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148614020 missense probably damaging 1.00
IGL02997:Masp2 APN 4 148603175 splice site probably benign
R0408:Masp2 UTSW 4 148606039 missense probably benign
R1517:Masp2 UTSW 4 148612106 missense possibly damaging 0.74
R1630:Masp2 UTSW 4 148614033 missense probably benign 0.07
R1634:Masp2 UTSW 4 148614355 missense probably damaging 1.00
R1873:Masp2 UTSW 4 148614495 missense probably damaging 1.00
R2208:Masp2 UTSW 4 148614415 missense probably damaging 1.00
R2283:Masp2 UTSW 4 148606068 missense probably benign 0.00
R2876:Masp2 UTSW 4 148608001 missense probably benign
R3921:Masp2 UTSW 4 148605731 missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148613901 missense probably damaging 1.00
R4753:Masp2 UTSW 4 148612151 missense probably benign 0.00
R4877:Masp2 UTSW 4 148602871 missense probably benign 0.00
R5169:Masp2 UTSW 4 148606114 missense probably damaging 0.96
R5512:Masp2 UTSW 4 148614069 missense probably damaging 1.00
R6291:Masp2 UTSW 4 148602753 missense probably damaging 0.99
R7039:Masp2 UTSW 4 148602586 start codon destroyed probably benign 0.03
R7164:Masp2 UTSW 4 148610115 critical splice acceptor site probably null
R7183:Masp2 UTSW 4 148612157 missense probably benign 0.02
R7417:Masp2 UTSW 4 148605721 missense probably benign 0.02
R7718:Masp2 UTSW 4 148602747 missense probably damaging 1.00
R7748:Masp2 UTSW 4 148605706 missense probably benign 0.00
R7852:Masp2 UTSW 4 148602732 missense probably benign 0.00
R7986:Masp2 UTSW 4 148602826 missense probably damaging 1.00
R8078:Masp2 UTSW 4 148613778 missense probably benign 0.01
R8203:Masp2 UTSW 4 148612142 missense probably benign 0.00
R8257:Masp2 UTSW 4 148603040 missense possibly damaging 0.82
R8465:Masp2 UTSW 4 148612059 missense possibly damaging 0.79
X0025:Masp2 UTSW 4 148602723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGGGTCAAACTACAGC -3'
(R):5'- GTGGTCAGCAATTGGTATGTCC -3'

Sequencing Primer
(F):5'- CTGGGTCAAACTACAGCAGCAG -3'
(R):5'- GTCCACAAACATTAGGTTTCTAGC -3'
Posted On2017-10-10