Incidental Mutation 'R6161:Rpap2'
ID489862
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107620670 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 458 (E458G)
Ref Sequence ENSEMBL: ENSMUSP00000108274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655]
Predicted Effect probably damaging
Transcript: ENSMUST00000065422
AA Change: E458G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773
AA Change: E458G

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112650
AA Change: E379G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773
AA Change: E379G

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112651
AA Change: E381G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773
AA Change: E381G

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112654
AA Change: E458G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773
AA Change: E458G

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112655
AA Change: E458G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773
AA Change: E458G

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R0077:Rpap2 UTSW 5 107620474 missense probably damaging 1.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4007:Rpap2 UTSW 5 107603872 missense probably damaging 1.00
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6142:Rpap2 UTSW 5 107598298 missense probably benign
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6761:Rpap2 UTSW 5 107620238 missense probably benign
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7106:Rpap2 UTSW 5 107633122 nonsense probably null
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
R7644:Rpap2 UTSW 5 107620301 missense probably benign 0.04
R7782:Rpap2 UTSW 5 107620192 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAACCCTCTTCAGCCTCTGAG -3'
(R):5'- TCTAAGTGACCGACCTACCC -3'

Sequencing Primer
(F):5'- CCTCTGAGCCTGATGAAGAACTTG -3'
(R):5'- TACCCCACTGCAGAGCGAG -3'
Posted On2017-10-10