Incidental Mutation 'R6161:Fbxw8'
ID489863
Institutional Source Beutler Lab
Gene Symbol Fbxw8
Ensembl Gene ENSMUSG00000032867
Gene NameF-box and WD-40 domain protein 8
SynonymsFbx29, FBW6, FBXO29, 4930438M06Rik, FBW8
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location118064965-118155464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118092675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 354 (T354A)
Ref Sequence ENSEMBL: ENSMUSP00000047012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049474
AA Change: T354A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867
AA Change: T354A

DomainStartEndE-ValueType
low complexity region 16 39 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
FBOX 119 159 5e-5 SMART
WD40 198 236 6.16e0 SMART
WD40 248 285 7.1e1 SMART
WD40 289 327 7.36e1 SMART
Blast:WD40 373 418 2e-8 BLAST
WD40 421 461 1.6e0 SMART
WD40 464 501 2.15e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201545
Meta Mutation Damage Score 0.1239 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Fbxw8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Fbxw8 APN 5 118068097 missense probably benign 0.00
IGL00435:Fbxw8 APN 5 118068137 missense probably benign 0.01
IGL00674:Fbxw8 APN 5 118095593 missense possibly damaging 0.94
IGL01306:Fbxw8 APN 5 118113720 missense possibly damaging 0.88
IGL02389:Fbxw8 APN 5 118128955 missense possibly damaging 0.57
IGL02438:Fbxw8 APN 5 118095693 missense probably benign 0.09
IGL02553:Fbxw8 APN 5 118066060 unclassified probably benign
IGL02752:Fbxw8 APN 5 118142750 missense probably damaging 1.00
IGL02975:Fbxw8 APN 5 118077695 missense probably benign 0.02
IGL03177:Fbxw8 APN 5 118128980 splice site probably benign
IGL03333:Fbxw8 APN 5 118095595 missense possibly damaging 0.94
IGL03407:Fbxw8 APN 5 118142676 missense probably damaging 1.00
ANU23:Fbxw8 UTSW 5 118113720 missense possibly damaging 0.88
R0135:Fbxw8 UTSW 5 118070487 missense probably damaging 1.00
R0760:Fbxw8 UTSW 5 118065901 unclassified probably null
R1115:Fbxw8 UTSW 5 118077571 splice site probably benign
R1498:Fbxw8 UTSW 5 118065785 unclassified probably benign
R1689:Fbxw8 UTSW 5 118077617 missense probably damaging 0.97
R1897:Fbxw8 UTSW 5 118128876 missense probably benign 0.16
R2160:Fbxw8 UTSW 5 118124988 missense probably damaging 1.00
R2345:Fbxw8 UTSW 5 118065807 unclassified probably benign
R3743:Fbxw8 UTSW 5 118113639 missense probably damaging 1.00
R3935:Fbxw8 UTSW 5 118095718 missense probably benign 0.38
R4910:Fbxw8 UTSW 5 118125027 splice site probably null
R5220:Fbxw8 UTSW 5 118095711 missense possibly damaging 0.69
R5628:Fbxw8 UTSW 5 118092557 missense probably damaging 1.00
R6184:Fbxw8 UTSW 5 118113749 missense probably damaging 1.00
R6582:Fbxw8 UTSW 5 118124963 missense probably benign 0.28
R6617:Fbxw8 UTSW 5 118142666 critical splice donor site probably null
R6785:Fbxw8 UTSW 5 118092689 missense probably damaging 1.00
R7363:Fbxw8 UTSW 5 118124992 missense probably damaging 0.97
R7395:Fbxw8 UTSW 5 118068215 missense probably damaging 1.00
R7674:Fbxw8 UTSW 5 118124971 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGTTAATGTATACATGCCACTG -3'
(R):5'- CCTTCTCAGAGTGCACTTGG -3'

Sequencing Primer
(F):5'- AATGTATACATGCCACTGTTTCC -3'
(R):5'- CAGAGTGCACTTGGTTTTCAC -3'
Posted On2017-10-10