Incidental Mutation 'R6161:Klhl35'
ID489868
Institutional Source Beutler Lab
Gene Symbol Klhl35
Ensembl Gene ENSMUSG00000035298
Gene Namekelch-like 35
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99466004-99474022 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 99473337 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000037359] [ENSMUST00000107096] [ENSMUST00000152424]
Predicted Effect probably benign
Transcript: ENSMUST00000032998
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037359
SMART Domains Protein: ENSMUSP00000041363
Gene: ENSMUSG00000035298

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
BTB 40 141 5.82e-17 SMART
BACK 146 248 1.21e-27 SMART
Kelch 292 341 6.32e-2 SMART
Kelch 342 385 1.18e-5 SMART
Kelch 386 432 3.01e-12 SMART
Kelch 433 480 2.23e-1 SMART
Kelch 481 522 2.71e-5 SMART
Kelch 523 570 1.39e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107096
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142339
Predicted Effect unknown
Transcript: ENSMUST00000152424
AA Change: N127D
SMART Domains Protein: ENSMUSP00000120346
Gene: ENSMUSG00000035298
AA Change: N127D

DomainStartEndE-ValueType
Pfam:Kelch_1 1 34 1.1e-8 PFAM
Pfam:Kelch_6 36 79 3.6e-8 PFAM
Pfam:Kelch_1 38 76 2.6e-7 PFAM
low complexity region 106 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153736
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Klhl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Klhl35 APN 7 99471681 splice site probably benign
IGL03003:Klhl35 APN 7 99470343 missense probably damaging 0.98
R0268:Klhl35 UTSW 7 99471751 missense probably benign 0.33
R1563:Klhl35 UTSW 7 99471695 missense probably damaging 1.00
R1770:Klhl35 UTSW 7 99473875 missense possibly damaging 0.57
R1901:Klhl35 UTSW 7 99470220 missense probably damaging 1.00
R2392:Klhl35 UTSW 7 99473824 missense possibly damaging 0.72
R3810:Klhl35 UTSW 7 99470241 missense probably benign 0.07
R4194:Klhl35 UTSW 7 99473851 unclassified probably null
R4349:Klhl35 UTSW 7 99473719 missense probably benign 0.18
R4960:Klhl35 UTSW 7 99469068 missense probably damaging 1.00
R5846:Klhl35 UTSW 7 99472887 missense probably damaging 0.97
R6494:Klhl35 UTSW 7 99472899 missense probably damaging 1.00
R7060:Klhl35 UTSW 7 99468458 missense possibly damaging 0.81
R7758:Klhl35 UTSW 7 99473218 missense unknown
R7762:Klhl35 UTSW 7 99468440 missense probably benign 0.11
R8022:Klhl35 UTSW 7 99473239 missense unknown
X0023:Klhl35 UTSW 7 99470341 nonsense probably null
X0064:Klhl35 UTSW 7 99471841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGTCTAGGGCCAAAATGTAAG -3'
(R):5'- AGCCTTCATTTGATCTTAGCCAG -3'

Sequencing Primer
(F):5'- GACATAGAATTCAAGTTCTGGGACTG -3'
(R):5'- CCTTCATTTGATCTTAGCCAGAAAGC -3'
Posted On2017-10-10