Incidental Mutation 'R6161:Abca16'
ID 489870
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120139934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 1533 (K1533M)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: K1532M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: K1532M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: K1533M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: K1533M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 C T 10: 83,356,202 (GRCm39) V63I probably benign Het
Atr A G 9: 95,747,372 (GRCm39) H218R probably benign Het
Atxn7l1 T A 12: 33,408,662 (GRCm39) S275T possibly damaging Het
Cacna1c T C 6: 119,034,263 (GRCm39) K88R probably damaging Het
Ccl7 T C 11: 81,937,412 (GRCm39) Y49H probably damaging Het
Cers5 A G 15: 99,636,544 (GRCm39) probably null Het
Chuk T C 19: 44,071,076 (GRCm39) E543G probably damaging Het
Dip2c T C 13: 9,697,043 (GRCm39) V1318A probably damaging Het
Ercc5 A G 1: 44,206,512 (GRCm39) H475R probably benign Het
Fat3 A G 9: 16,288,818 (GRCm39) L235P probably damaging Het
Fbn1 A T 2: 125,211,721 (GRCm39) C892* probably null Het
Fbxw8 T C 5: 118,230,740 (GRCm39) T354A possibly damaging Het
Fsip2 A C 2: 82,817,601 (GRCm39) T4445P possibly damaging Het
Gpld1 A T 13: 25,155,397 (GRCm39) Q344L probably benign Het
Hao1 A T 2: 134,347,545 (GRCm39) D253E probably benign Het
Hmcn2 A G 2: 31,246,266 (GRCm39) D745G probably benign Het
Kcnt1 A G 2: 25,793,397 (GRCm39) T658A probably benign Het
Klhl35 A G 7: 99,122,544 (GRCm39) probably benign Het
Lnx2 C T 5: 146,978,836 (GRCm39) probably null Het
Map3k5 T C 10: 19,876,321 (GRCm39) V160A probably damaging Het
Masp2 A T 4: 148,698,469 (GRCm39) I517F possibly damaging Het
Mc4r A T 18: 66,992,251 (GRCm39) Y287* probably null Het
Mthfr A G 4: 148,126,211 (GRCm39) D94G probably benign Het
Muc16 A G 9: 18,559,114 (GRCm39) I2393T unknown Het
Mybbp1a G T 11: 72,336,838 (GRCm39) V557L probably damaging Het
Mycbp2 A T 14: 103,536,183 (GRCm39) W256R probably damaging Het
Nacad G A 11: 6,550,902 (GRCm39) S763L probably benign Het
Nebl A G 2: 17,735,641 (GRCm39) V11A probably benign Het
Notch1 A T 2: 26,358,743 (GRCm39) C1363S probably damaging Het
Nphp3 A G 9: 103,909,105 (GRCm39) N772D probably benign Het
Nqo2 G A 13: 34,163,634 (GRCm39) V98M probably damaging Het
Pak4 A G 7: 28,264,692 (GRCm39) I70T possibly damaging Het
Pbx2 A G 17: 34,812,574 (GRCm39) K2E probably damaging Het
Pikfyve A G 1: 65,255,202 (GRCm39) T352A probably benign Het
Polr1g G A 7: 19,091,558 (GRCm39) T183I possibly damaging Het
Pop1 T C 15: 34,526,456 (GRCm39) Y684H probably damaging Het
Rpa1 A G 11: 75,205,721 (GRCm39) V212A probably damaging Het
Rpap2 A G 5: 107,768,536 (GRCm39) E458G probably damaging Het
Sin3a T C 9: 57,002,708 (GRCm39) V200A possibly damaging Het
Sla T C 15: 66,654,447 (GRCm39) T280A probably null Het
Slc22a26 A T 19: 7,763,812 (GRCm39) I406K possibly damaging Het
Slc24a1 T C 9: 64,844,545 (GRCm39) N606S unknown Het
Slc39a10 G A 1: 46,866,567 (GRCm39) T443M probably damaging Het
Smg1 A T 7: 117,762,553 (GRCm39) probably benign Het
Sra1 G A 18: 36,803,336 (GRCm39) A9V probably damaging Het
Stard4 A G 18: 33,342,109 (GRCm39) V47A probably damaging Het
Stat4 A T 1: 52,113,836 (GRCm39) D182V possibly damaging Het
Syt1 A G 10: 108,467,668 (GRCm39) F210L probably damaging Het
Ube2q1 T A 3: 89,688,667 (GRCm39) probably null Het
Vmn1r159 C T 7: 22,542,612 (GRCm39) C140Y possibly damaging Het
Wnt8a T C 18: 34,678,599 (GRCm39) F138L possibly damaging Het
Zfp623 T A 15: 75,820,470 (GRCm39) D475E probably benign Het
Zfp646 C T 7: 127,477,897 (GRCm39) R25W probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTTAACCTTTTGCAGATTTGAAC -3'
(R):5'- AGCAGGTTCACCCACAGTTG -3'

Sequencing Primer
(F):5'- TCTGTAACTCCTTGGAAATCACAC -3'
(R):5'- ACCCACAGTTGCTTCTCTGTAG -3'
Posted On 2017-10-10