Mutagenetix > Incidental Mutation

Incidental Mutation 'R6161:Sin3a'

489874

Institutional Source

Beutler Lab

Gene Symbol

Sin3a

Ensembl Gene

ENSMUSG00000042557

Gene Name

transcriptional regulator, SIN3A (yeast)

Synonyms

Sin3, mSin3A

MMRRC Submission

044308-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57072040-57128366 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57095424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 200 (V200A)

Ref Sequence

ENSEMBL: ENSMUSP00000126601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]

AlphaFold

Q60520

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049169
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: V200A

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125333

Predicted Effect

probably benign
Transcript: ENSMUST00000163400

SMART Domains

Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
Pfam:PAH	82	128	2.1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165927

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167715
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: V200A

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168177
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: V200A

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	142	186	5.3e-22	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	323	380	9.6e-22	PFAM
Pfam:PAH	479	523	8.1e-11	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
Pfam:Sin3a_C	887	1190	1.2e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168502
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: V200A

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1138	1154	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168678
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: V200A

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Sin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Sin3a	APN	9	57097901	missense	probably damaging	1.00
IGL00836:Sin3a	APN	9	57107345	splice site	probably null
IGL00913:Sin3a	APN	9	57098118	missense	probably benign	0.01
IGL01721:Sin3a	APN	9	57095325	missense	probably damaging	1.00
IGL01964:Sin3a	APN	9	57107347	splice site	probably benign
IGL02333:Sin3a	APN	9	57107559	missense	possibly damaging	0.86
IGL02673:Sin3a	APN	9	57107441	missense	probably damaging	0.99
Crumbled	UTSW	9	57110654	nonsense	probably null
Delicate	UTSW	9	57103929	missense	probably damaging	1.00
IGL03014:Sin3a	UTSW	9	57095255	intron	probably benign
PIT4519001:Sin3a	UTSW	9	57095456	missense	possibly damaging	0.86
R0024:Sin3a	UTSW	9	57118253	intron	probably benign
R0309:Sin3a	UTSW	9	57110912	missense	probably benign	0.00
R0511:Sin3a	UTSW	9	57096895	nonsense	probably null
R1205:Sin3a	UTSW	9	57119175	missense	probably damaging	1.00
R1365:Sin3a	UTSW	9	57125203	nonsense	probably null
R1496:Sin3a	UTSW	9	57119158	missense	possibly damaging	0.77
R1544:Sin3a	UTSW	9	57103997	splice site	probably benign
R1958:Sin3a	UTSW	9	57105609	missense	probably damaging	1.00
R1993:Sin3a	UTSW	9	57101199	missense	probably damaging	1.00
R2037:Sin3a	UTSW	9	57096825	missense	probably benign	0.14
R2065:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R2079:Sin3a	UTSW	9	57089523	missense	probably benign
R2193:Sin3a	UTSW	9	57117477	missense	possibly damaging	0.93
R3004:Sin3a	UTSW	9	57096834	nonsense	probably null
R3929:Sin3a	UTSW	9	57118137	missense	probably damaging	0.98
R4326:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4327:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4329:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4765:Sin3a	UTSW	9	57096803	missense	probably benign	0.14
R4806:Sin3a	UTSW	9	57086742	missense	probably damaging	0.99
R4979:Sin3a	UTSW	9	57118076	missense	probably damaging	1.00
R5018:Sin3a	UTSW	9	57110891	missense	probably benign	0.00
R5368:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R5379:Sin3a	UTSW	9	57110988	missense	probably benign	0.10
R5391:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5395:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5519:Sin3a	UTSW	9	57118173	critical splice donor site	probably null
R5927:Sin3a	UTSW	9	57111111	missense	probably damaging	1.00
R5987:Sin3a	UTSW	9	57127200	missense	possibly damaging	0.75
R6083:Sin3a	UTSW	9	57107540	missense	probably damaging	1.00
R6196:Sin3a	UTSW	9	57103929	missense	probably damaging	1.00
R6374:Sin3a	UTSW	9	57117481	missense	probably benign
R6456:Sin3a	UTSW	9	57113701	missense	possibly damaging	0.79
R6815:Sin3a	UTSW	9	57117540	missense	probably benign	0.02
R6900:Sin3a	UTSW	9	57107574	missense	probably damaging	1.00
R7051:Sin3a	UTSW	9	57103934	missense	probably damaging	1.00
R7081:Sin3a	UTSW	9	57094471	missense	probably null	1.00
R7285:Sin3a	UTSW	9	57127299	missense	possibly damaging	0.57
R7462:Sin3a	UTSW	9	57095525	missense	probably benign	0.00
R7538:Sin3a	UTSW	9	57103926	missense	possibly damaging	0.95
R7699:Sin3a	UTSW	9	57110654	nonsense	probably null
R8150:Sin3a	UTSW	9	57127284	missense	possibly damaging	0.92
R8158:Sin3a	UTSW	9	57113544	critical splice acceptor site	probably null
R8717:Sin3a	UTSW	9	57127226	missense	probably damaging	0.99
R9048:Sin3a	UTSW	9	57125336	missense	probably damaging	0.99
R9283:Sin3a	UTSW	9	57095433	missense	probably damaging	0.99
R9300:Sin3a	UTSW	9	57107460	missense	probably damaging	1.00
R9330:Sin3a	UTSW	9	57125197	missense	probably damaging	1.00
R9396:Sin3a	UTSW	9	57101161	missense	probably benign	0.28
R9550:Sin3a	UTSW	9	57089484	missense	probably benign	0.00
R9746:Sin3a	UTSW	9	57118074	missense	probably benign	0.11
RF017:Sin3a	UTSW	9	57127326	missense	possibly damaging	0.90
X0026:Sin3a	UTSW	9	57125192	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCCAAGCTTGCTTTTCATAGC -3'
(R):5'- AGGACACTGTTGTAACTTGTGTAC -3'

Sequencing Primer
(F):5'- AAGCTTGCTTTTCATAGCTTTCC -3'
(R):5'- CACTGTTGTAACTTGTGTACACCGG -3'

Posted On

2017-10-10