Incidental Mutation 'R6161:Sin3a'
ID 489874
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Name transcriptional regulator, SIN3A (yeast)
Synonyms Sin3, mSin3A
MMRRC Submission 044308-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 56979324-57035650 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57002708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
AlphaFold Q60520
Predicted Effect possibly damaging
Transcript: ENSMUST00000049169
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably benign
Transcript: ENSMUST00000163400
SMART Domains Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

DomainStartEndE-ValueType
Pfam:PAH 82 128 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165927
Predicted Effect possibly damaging
Transcript: ENSMUST00000167715
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168177
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168502
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168678
AA Change: V200A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: V200A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,139,934 (GRCm39) K1533M probably damaging Het
Aldh1l2 C T 10: 83,356,202 (GRCm39) V63I probably benign Het
Atr A G 9: 95,747,372 (GRCm39) H218R probably benign Het
Atxn7l1 T A 12: 33,408,662 (GRCm39) S275T possibly damaging Het
Cacna1c T C 6: 119,034,263 (GRCm39) K88R probably damaging Het
Ccl7 T C 11: 81,937,412 (GRCm39) Y49H probably damaging Het
Cers5 A G 15: 99,636,544 (GRCm39) probably null Het
Chuk T C 19: 44,071,076 (GRCm39) E543G probably damaging Het
Dip2c T C 13: 9,697,043 (GRCm39) V1318A probably damaging Het
Ercc5 A G 1: 44,206,512 (GRCm39) H475R probably benign Het
Fat3 A G 9: 16,288,818 (GRCm39) L235P probably damaging Het
Fbn1 A T 2: 125,211,721 (GRCm39) C892* probably null Het
Fbxw8 T C 5: 118,230,740 (GRCm39) T354A possibly damaging Het
Fsip2 A C 2: 82,817,601 (GRCm39) T4445P possibly damaging Het
Gpld1 A T 13: 25,155,397 (GRCm39) Q344L probably benign Het
Hao1 A T 2: 134,347,545 (GRCm39) D253E probably benign Het
Hmcn2 A G 2: 31,246,266 (GRCm39) D745G probably benign Het
Kcnt1 A G 2: 25,793,397 (GRCm39) T658A probably benign Het
Klhl35 A G 7: 99,122,544 (GRCm39) probably benign Het
Lnx2 C T 5: 146,978,836 (GRCm39) probably null Het
Map3k5 T C 10: 19,876,321 (GRCm39) V160A probably damaging Het
Masp2 A T 4: 148,698,469 (GRCm39) I517F possibly damaging Het
Mc4r A T 18: 66,992,251 (GRCm39) Y287* probably null Het
Mthfr A G 4: 148,126,211 (GRCm39) D94G probably benign Het
Muc16 A G 9: 18,559,114 (GRCm39) I2393T unknown Het
Mybbp1a G T 11: 72,336,838 (GRCm39) V557L probably damaging Het
Mycbp2 A T 14: 103,536,183 (GRCm39) W256R probably damaging Het
Nacad G A 11: 6,550,902 (GRCm39) S763L probably benign Het
Nebl A G 2: 17,735,641 (GRCm39) V11A probably benign Het
Notch1 A T 2: 26,358,743 (GRCm39) C1363S probably damaging Het
Nphp3 A G 9: 103,909,105 (GRCm39) N772D probably benign Het
Nqo2 G A 13: 34,163,634 (GRCm39) V98M probably damaging Het
Pak4 A G 7: 28,264,692 (GRCm39) I70T possibly damaging Het
Pbx2 A G 17: 34,812,574 (GRCm39) K2E probably damaging Het
Pikfyve A G 1: 65,255,202 (GRCm39) T352A probably benign Het
Polr1g G A 7: 19,091,558 (GRCm39) T183I possibly damaging Het
Pop1 T C 15: 34,526,456 (GRCm39) Y684H probably damaging Het
Rpa1 A G 11: 75,205,721 (GRCm39) V212A probably damaging Het
Rpap2 A G 5: 107,768,536 (GRCm39) E458G probably damaging Het
Sla T C 15: 66,654,447 (GRCm39) T280A probably null Het
Slc22a26 A T 19: 7,763,812 (GRCm39) I406K possibly damaging Het
Slc24a1 T C 9: 64,844,545 (GRCm39) N606S unknown Het
Slc39a10 G A 1: 46,866,567 (GRCm39) T443M probably damaging Het
Smg1 A T 7: 117,762,553 (GRCm39) probably benign Het
Sra1 G A 18: 36,803,336 (GRCm39) A9V probably damaging Het
Stard4 A G 18: 33,342,109 (GRCm39) V47A probably damaging Het
Stat4 A T 1: 52,113,836 (GRCm39) D182V possibly damaging Het
Syt1 A G 10: 108,467,668 (GRCm39) F210L probably damaging Het
Ube2q1 T A 3: 89,688,667 (GRCm39) probably null Het
Vmn1r159 C T 7: 22,542,612 (GRCm39) C140Y possibly damaging Het
Wnt8a T C 18: 34,678,599 (GRCm39) F138L possibly damaging Het
Zfp623 T A 15: 75,820,470 (GRCm39) D475E probably benign Het
Zfp646 C T 7: 127,477,897 (GRCm39) R25W probably damaging Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57,005,185 (GRCm39) missense probably damaging 1.00
IGL00836:Sin3a APN 9 57,014,629 (GRCm39) splice site probably null
IGL00913:Sin3a APN 9 57,005,402 (GRCm39) missense probably benign 0.01
IGL01721:Sin3a APN 9 57,002,609 (GRCm39) missense probably damaging 1.00
IGL01964:Sin3a APN 9 57,014,631 (GRCm39) splice site probably benign
IGL02333:Sin3a APN 9 57,014,843 (GRCm39) missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57,014,725 (GRCm39) missense probably damaging 0.99
Crumbled UTSW 9 57,017,938 (GRCm39) nonsense probably null
Delicate UTSW 9 57,011,213 (GRCm39) missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57,002,539 (GRCm39) intron probably benign
PIT4519001:Sin3a UTSW 9 57,002,740 (GRCm39) missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57,025,537 (GRCm39) intron probably benign
R0309:Sin3a UTSW 9 57,018,196 (GRCm39) missense probably benign 0.00
R0511:Sin3a UTSW 9 57,004,179 (GRCm39) nonsense probably null
R1205:Sin3a UTSW 9 57,026,459 (GRCm39) missense probably damaging 1.00
R1365:Sin3a UTSW 9 57,032,487 (GRCm39) nonsense probably null
R1496:Sin3a UTSW 9 57,026,442 (GRCm39) missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57,011,281 (GRCm39) splice site probably benign
R1958:Sin3a UTSW 9 57,012,893 (GRCm39) missense probably damaging 1.00
R1993:Sin3a UTSW 9 57,008,483 (GRCm39) missense probably damaging 1.00
R2037:Sin3a UTSW 9 57,004,109 (GRCm39) missense probably benign 0.14
R2065:Sin3a UTSW 9 57,018,084 (GRCm39) missense possibly damaging 0.93
R2079:Sin3a UTSW 9 56,996,807 (GRCm39) missense probably benign
R2193:Sin3a UTSW 9 57,024,761 (GRCm39) missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57,004,118 (GRCm39) nonsense probably null
R3929:Sin3a UTSW 9 57,025,421 (GRCm39) missense probably damaging 0.98
R4326:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4327:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4329:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4765:Sin3a UTSW 9 57,004,087 (GRCm39) missense probably benign 0.14
R4806:Sin3a UTSW 9 56,994,026 (GRCm39) missense probably damaging 0.99
R4979:Sin3a UTSW 9 57,025,360 (GRCm39) missense probably damaging 1.00
R5018:Sin3a UTSW 9 57,018,175 (GRCm39) missense probably benign 0.00
R5368:Sin3a UTSW 9 57,018,084 (GRCm39) missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57,018,272 (GRCm39) missense probably benign 0.10
R5391:Sin3a UTSW 9 57,012,957 (GRCm39) missense probably damaging 1.00
R5395:Sin3a UTSW 9 57,012,957 (GRCm39) missense probably damaging 1.00
R5519:Sin3a UTSW 9 57,025,457 (GRCm39) critical splice donor site probably null
R5927:Sin3a UTSW 9 57,018,395 (GRCm39) missense probably damaging 1.00
R5987:Sin3a UTSW 9 57,034,484 (GRCm39) missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57,014,824 (GRCm39) missense probably damaging 1.00
R6196:Sin3a UTSW 9 57,011,213 (GRCm39) missense probably damaging 1.00
R6374:Sin3a UTSW 9 57,024,765 (GRCm39) missense probably benign
R6456:Sin3a UTSW 9 57,020,985 (GRCm39) missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57,024,824 (GRCm39) missense probably benign 0.02
R6900:Sin3a UTSW 9 57,014,858 (GRCm39) missense probably damaging 1.00
R7051:Sin3a UTSW 9 57,011,218 (GRCm39) missense probably damaging 1.00
R7081:Sin3a UTSW 9 57,001,755 (GRCm39) missense probably null 1.00
R7285:Sin3a UTSW 9 57,034,583 (GRCm39) missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57,002,809 (GRCm39) missense probably benign 0.00
R7538:Sin3a UTSW 9 57,011,210 (GRCm39) missense possibly damaging 0.95
R7699:Sin3a UTSW 9 57,017,938 (GRCm39) nonsense probably null
R8150:Sin3a UTSW 9 57,034,568 (GRCm39) missense possibly damaging 0.92
R8158:Sin3a UTSW 9 57,020,828 (GRCm39) critical splice acceptor site probably null
R8717:Sin3a UTSW 9 57,034,510 (GRCm39) missense probably damaging 0.99
R9048:Sin3a UTSW 9 57,032,620 (GRCm39) missense probably damaging 0.99
R9283:Sin3a UTSW 9 57,002,717 (GRCm39) missense probably damaging 0.99
R9300:Sin3a UTSW 9 57,014,744 (GRCm39) missense probably damaging 1.00
R9330:Sin3a UTSW 9 57,032,481 (GRCm39) missense probably damaging 1.00
R9396:Sin3a UTSW 9 57,008,445 (GRCm39) missense probably benign 0.28
R9550:Sin3a UTSW 9 56,996,768 (GRCm39) missense probably benign 0.00
R9746:Sin3a UTSW 9 57,025,358 (GRCm39) missense probably benign 0.11
RF017:Sin3a UTSW 9 57,034,610 (GRCm39) missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57,032,476 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCAAGCTTGCTTTTCATAGC -3'
(R):5'- AGGACACTGTTGTAACTTGTGTAC -3'

Sequencing Primer
(F):5'- AAGCTTGCTTTTCATAGCTTTCC -3'
(R):5'- CACTGTTGTAACTTGTGTACACCGG -3'
Posted On 2017-10-10