Incidental Mutation 'R6161:Nphp3'
ID489877
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104031906 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 772 (N772D)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774]
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: N772D

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: N772D

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129819
AA Change: N652D
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: N652D

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192485
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: N652D
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: N652D

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTAGTGTGCACATGTATGAAAG -3'
(R):5'- TGTTGGACAGGTTTCACATGC -3'

Sequencing Primer
(F):5'- GCACATGTATGAAAGTATGGATGTC -3'
(R):5'- GGACAGGTTTCACATGCAATTTAAAG -3'
Posted On2017-10-10