Incidental Mutation 'R6161:Aldh1l2'
ID 489879
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83520338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: V176I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: V176I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: V63I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83506642 missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83508677 missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83506681 missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
R9784:Aldh1l2 UTSW 10 83506750 critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTCACAGACTTTCAAGCTC -3'
(R):5'- AGGCCACTATCTGCGTTTGC -3'

Sequencing Primer
(F):5'- GCTCCAATTTACATTACAGCCATGTG -3'
(R):5'- GCGTTTGCAATGTAACCTCC -3'
Posted On 2017-10-10