Mutagenetix > Incidental Mutation

Incidental Mutation 'R6161:Mybbp1a'

489882

Institutional Source

Beutler Lab

Gene Symbol

Mybbp1a

Ensembl Gene

ENSMUSG00000040463

Gene Name

MYB binding protein (P160) 1a

Synonyms

p160MBP, p67MBP

MMRRC Submission

044308-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72441355-72451768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 72446012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 557 (V557L)

Ref Sequence

ENSEMBL: ENSMUSP00000044827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045633]

AlphaFold

Q7TPV4

Predicted Effect

probably damaging
Transcript: ENSMUST00000045633
AA Change: V557L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: V557L

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
Pfam:DNA_pol_phi	70	835	1.2e-194	PFAM
low complexity region	839	852	N/A	INTRINSIC
low complexity region	1080	1090	N/A	INTRINSIC
low complexity region	1109	1122	N/A	INTRINSIC
low complexity region	1259	1269	N/A	INTRINSIC
low complexity region	1314	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152894

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155995

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162048

Meta Mutation Damage Score

0.6296

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Mybbp1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00924:Mybbp1a	APN	11	72443567	missense	probably damaging	1.00
IGL03240:Mybbp1a	APN	11	72445666	missense	possibly damaging	0.95
IGL03271:Mybbp1a	APN	11	72443918	splice site	probably benign
IGL03344:Mybbp1a	APN	11	72445202	missense	probably damaging	1.00
fratelli	UTSW	11	72445712	missense	probably benign	0.02
primi	UTSW	11	72442901	splice site	probably null
sorelli	UTSW	11	72447759	missense	possibly damaging	0.94
R0276:Mybbp1a	UTSW	11	72450107	splice site	probably null
R0437:Mybbp1a	UTSW	11	72448848	missense	possibly damaging	0.75
R0551:Mybbp1a	UTSW	11	72448376	missense	probably benign	0.06
R1394:Mybbp1a	UTSW	11	72443648	missense	probably damaging	1.00
R1667:Mybbp1a	UTSW	11	72445217	missense	probably benign	0.00
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1891:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1894:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R2074:Mybbp1a	UTSW	11	72441445	missense	probably benign	0.01
R2257:Mybbp1a	UTSW	11	72446195	missense	probably benign	0.10
R3739:Mybbp1a	UTSW	11	72448737	missense	possibly damaging	0.77
R3983:Mybbp1a	UTSW	11	72447170	missense	probably damaging	1.00
R4191:Mybbp1a	UTSW	11	72451287	missense	probably damaging	0.97
R4660:Mybbp1a	UTSW	11	72445712	missense	probably benign	0.02
R4667:Mybbp1a	UTSW	11	72447971	missense	possibly damaging	0.94
R4769:Mybbp1a	UTSW	11	72445640	missense	probably damaging	1.00
R4982:Mybbp1a	UTSW	11	72445214	missense	probably damaging	0.99
R5451:Mybbp1a	UTSW	11	72448113	missense	probably damaging	0.99
R5514:Mybbp1a	UTSW	11	72450636	missense	possibly damaging	0.61
R5548:Mybbp1a	UTSW	11	72446172	missense	probably damaging	1.00
R5673:Mybbp1a	UTSW	11	72444925	missense	probably benign	0.30
R5947:Mybbp1a	UTSW	11	72442431	missense	probably damaging	1.00
R6785:Mybbp1a	UTSW	11	72447566	missense	probably benign	0.00
R7154:Mybbp1a	UTSW	11	72447642	splice site	probably null
R7227:Mybbp1a	UTSW	11	72447759	missense	possibly damaging	0.94
R7238:Mybbp1a	UTSW	11	72443512	missense	probably damaging	1.00
R7441:Mybbp1a	UTSW	11	72451275	missense	probably benign	0.01
R7833:Mybbp1a	UTSW	11	72442901	splice site	probably null
R8213:Mybbp1a	UTSW	11	72444721	missense	probably damaging	1.00
R8324:Mybbp1a	UTSW	11	72445288	critical splice donor site	probably null
R8474:Mybbp1a	UTSW	11	72447737	missense	probably benign	0.01
R8972:Mybbp1a	UTSW	11	72446250	missense	probably benign	0.35
R9018:Mybbp1a	UTSW	11	72443594	missense	probably benign	0.09
R9380:Mybbp1a	UTSW	11	72442842	missense	probably benign	0.24
R9505:Mybbp1a	UTSW	11	72449071	missense	probably benign	0.26
X0050:Mybbp1a	UTSW	11	72441677	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTGAACAAGGTCAGCAG -3'
(R):5'- GGCCTCTAATTCCTTCAGAGTACTC -3'

Sequencing Primer
(F):5'- ACAAGGTCAGCAGGCCTG -3'
(R):5'- TCAGAGTACTCATCATCCTGGGG -3'

Posted On

2017-10-10