Incidental Mutation 'R6161:Rpa1'
ID489883
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Namereplication protein A1
SynonymsRpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75298166-75348324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75314895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000090585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
Predicted Effect probably damaging
Transcript: ENSMUST00000000767
AA Change: V233A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: V233A

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092907
AA Change: V212A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: V212A

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198372
Meta Mutation Damage Score 0.7989 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATAGCATCAAAGGTCTCCAACAG -3'
(R):5'- CAAACCTGTTTGTCATCTTGGGG -3'

Sequencing Primer
(F):5'- ACAATGACCGCCATGTTCCTC -3'
(R):5'- TGTCATCTTGGGGTTTTAATTAGC -3'
Posted On2017-10-10