Incidental Mutation 'R6161:Cers5'
ID489893
Institutional Source Beutler Lab
Gene Symbol Cers5
Ensembl Gene ENSMUSG00000023021
Gene Nameceramide synthase 5
SynonymsCerS5, Trh4, 2310081H14Rik, Lass5
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99734881-99772885 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 99738663 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023762] [ENSMUST00000109035] [ENSMUST00000175876] [ENSMUST00000176248]
Predicted Effect probably null
Transcript: ENSMUST00000023762
SMART Domains Protein: ENSMUSP00000023762
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
low complexity region 343 361 N/A INTRINSIC
low complexity region 366 382 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109035
SMART Domains Protein: ENSMUSP00000104663
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 6e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175876
SMART Domains Protein: ENSMUSP00000134845
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
HOX 29 91 5.6e-2 SMART
TLC 90 241 1.29e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176248
SMART Domains Protein: ENSMUSP00000135074
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-18 BLAST
HOX 78 140 2.8e-4 SMART
TLC 139 251 1.7e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176970
SMART Domains Protein: ENSMUSP00000135723
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
TLC 1 153 3.49e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TLC (TRAM, LAG1 and CLN8 homology domains) family of proteins. The encoded protein functions in the synthesis of ceramide, a lipid molecule that is involved in a several cellular signaling pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Cers5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Cers5 APN 15 99739655 nonsense probably null
coleman UTSW 15 99751238 nonsense probably null
R0178:Cers5 UTSW 15 99747024 splice site probably benign
R0483:Cers5 UTSW 15 99745914 missense probably damaging 1.00
R0589:Cers5 UTSW 15 99740956 missense probably damaging 1.00
R1433:Cers5 UTSW 15 99745931 nonsense probably null
R1757:Cers5 UTSW 15 99736331 missense probably benign 0.31
R2520:Cers5 UTSW 15 99736381 missense probably damaging 0.97
R3008:Cers5 UTSW 15 99772717 unclassified probably benign
R3010:Cers5 UTSW 15 99772717 unclassified probably benign
R3011:Cers5 UTSW 15 99772717 unclassified probably benign
R4379:Cers5 UTSW 15 99751253 missense probably damaging 1.00
R4732:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4733:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4911:Cers5 UTSW 15 99747079 missense probably damaging 1.00
R5441:Cers5 UTSW 15 99751238 nonsense probably null
R6089:Cers5 UTSW 15 99741002 missense probably benign 0.01
R6247:Cers5 UTSW 15 99745924 missense probably benign 0.03
R6300:Cers5 UTSW 15 99772219 missense probably damaging 1.00
R6312:Cers5 UTSW 15 99747115 missense probably benign 0.11
R6861:Cers5 UTSW 15 99772363 unclassified probably benign
R7780:Cers5 UTSW 15 99739708 missense probably damaging 1.00
R7800:Cers5 UTSW 15 99736241 missense probably benign 0.02
R7843:Cers5 UTSW 15 99772331 missense unknown
R7926:Cers5 UTSW 15 99772331 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCCAGTTTGTATGCTCAGC -3'
(R):5'- CTCCTTGTTCTAGGATTCTGAACAC -3'

Sequencing Primer
(F):5'- CAGGGTTTACAGGTATACATACGCC -3'
(R):5'- CAACCCTCTTTGAAAGCTGGGAG -3'
Posted On2017-10-10