Incidental Mutation 'R6161:Pbx2'
ID489894
Institutional Source Beutler Lab
Gene Symbol Pbx2
Ensembl Gene ENSMUSG00000034673
Gene Namepre B cell leukemia homeobox 2
SynonymsG17
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34591266-34597400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34593600 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2 (K2E)
Ref Sequence ENSEMBL: ENSMUSP00000133744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000038149] [ENSMUST00000038244] [ENSMUST00000150924] [ENSMUST00000173328] [ENSMUST00000173772] [ENSMUST00000173992] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000174532] [ENSMUST00000183827]
Predicted Effect probably benign
Transcript: ENSMUST00000015596
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038149
AA Change: K84E

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673
AA Change: K84E

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038244
SMART Domains Protein: ENSMUSP00000045911
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
GoLoco 61 83 2.02e-6 SMART
low complexity region 86 100 N/A INTRINSIC
GoLoco 103 125 2.42e-4 SMART
GoLoco 131 154 4.05e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173229
Predicted Effect probably damaging
Transcript: ENSMUST00000173328
AA Change: K2E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673
AA Change: K2E

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173772
SMART Domains Protein: ENSMUSP00000134130
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
GoLoco 27 50 4.05e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173992
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174069
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174496
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174532
AA Change: K2E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133744
Gene: ENSMUSG00000034673
AA Change: K2E

DomainStartEndE-ValueType
Pfam:PBC 1 148 3.5e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect possibly damaging
Transcript: ENSMUST00000183827
AA Change: K24E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673
AA Change: K24E

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed member of the TALE/PBX homeobox family. It was identified by its similarity to a homeobox gene which is involved in t(1;19) translocation in acute pre-B-cell leukemias. This protein is a transcriptional activator which binds to the TLX1 promoter. The gene is located within the major histocompatibility complex (MHC) on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Pbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Pbx2 APN 17 34595618 splice site probably benign
IGL01923:Pbx2 APN 17 34594050 missense probably damaging 1.00
R1748:Pbx2 UTSW 17 34593977 missense possibly damaging 0.81
R2182:Pbx2 UTSW 17 34595666 nonsense probably null
R4257:Pbx2 UTSW 17 34594645 missense probably damaging 1.00
R5011:Pbx2 UTSW 17 34594699 nonsense probably null
R6888:Pbx2 UTSW 17 34594107 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTGACTTTAGCCCCACTGC -3'
(R):5'- TCAAAGCTCCATCCTCGGTC -3'

Sequencing Primer
(F):5'- CTTCCCGAAGCTATGGCAG -3'
(R):5'- TCCATCCTCGGTCCCAGG -3'
Posted On2017-10-10