Incidental Mutation 'R6161:Stard4'
ID489895
Institutional Source Beutler Lab
Gene Symbol Stard4
Ensembl Gene ENSMUSG00000024378
Gene NameStAR-related lipid transfer (START) domain containing 4
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33199355-33213862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33209056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000114109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025236] [ENSMUST00000118990] [ENSMUST00000119991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025236
AA Change: V47A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025236
Gene: ENSMUSG00000024378
AA Change: V47A

DomainStartEndE-ValueType
START 25 224 1.43e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118990
AA Change: V47A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114131
Gene: ENSMUSG00000024378
AA Change: V47A

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 5e-78 PDB
SCOP:d1jssa_ 24 110 3e-17 SMART
Blast:START 25 110 4e-58 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119991
AA Change: V47A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114109
Gene: ENSMUSG00000024378
AA Change: V47A

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 1e-76 PDB
SCOP:d1jssa_ 24 110 8e-17 SMART
Blast:START 25 110 8e-57 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141617
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased liver weight, body weight, and body length. Female mice homozygous for this allele exhibit decreased circulating cholesterol when fed a low cholesterol diet and altered bile composition when fed standard chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Stard4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Stard4 UTSW 18 33205149 missense probably damaging 1.00
R1396:Stard4 UTSW 18 33206210 missense probably damaging 0.99
R1577:Stard4 UTSW 18 33205098 missense probably damaging 1.00
R5308:Stard4 UTSW 18 33203625 missense probably damaging 1.00
R5481:Stard4 UTSW 18 33205245 missense probably benign 0.03
R6393:Stard4 UTSW 18 33205225 missense probably benign 0.00
R7062:Stard4 UTSW 18 33205534 splice site probably null
R7478:Stard4 UTSW 18 33205324 missense unknown
R8805:Stard4 UTSW 18 33203696 missense possibly damaging 0.93
X0065:Stard4 UTSW 18 33209072 missense probably damaging 0.98
Z1088:Stard4 UTSW 18 33203717 missense probably benign 0.01
Z1088:Stard4 UTSW 18 33203720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCACCCATGAACCTATGATC -3'
(R):5'- TTCTGTAGCTCTCCCAGGAG -3'

Sequencing Primer
(F):5'- CAATCAAAGAGCTACTGGGTTC -3'
(R):5'- CTCCCAGGAGAATTTATTCTGAAAGG -3'
Posted On2017-10-10