Incidental Mutation 'R6161:Wnt8a'
ID489896
Institutional Source Beutler Lab
Gene Symbol Wnt8a
Ensembl Gene ENSMUSG00000012282
Gene Namewingless-type MMTV integration site family, member 8A
SynonymsStra11
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34542313-34548273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34545546 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 138 (F138L)
Ref Sequence ENSEMBL: ENSMUSP00000012426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012426]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012426
AA Change: F138L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012426
Gene: ENSMUSG00000012282
AA Change: F138L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
WNT1 21 337 2.26e-155 SMART
Meta Mutation Damage Score 0.7466 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Wnt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Wnt8a APN 18 34544793 missense probably damaging 0.98
IGL01823:Wnt8a APN 18 34544793 missense possibly damaging 0.85
IGL02964:Wnt8a APN 18 34542421 missense possibly damaging 0.86
PIT4486001:Wnt8a UTSW 18 34547583 missense probably damaging 1.00
R0496:Wnt8a UTSW 18 34544847 missense probably damaging 1.00
R0646:Wnt8a UTSW 18 34547565 missense probably benign 0.02
R1813:Wnt8a UTSW 18 34542369 start codon destroyed probably null 0.89
R1990:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R1991:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R1992:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R4927:Wnt8a UTSW 18 34547472 missense probably damaging 1.00
R5085:Wnt8a UTSW 18 34545603 nonsense probably null
R7719:Wnt8a UTSW 18 34547535 missense probably damaging 1.00
R8001:Wnt8a UTSW 18 34545516 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTGGGTAGAGAGAACCTAG -3'
(R):5'- TCTTCCTGAACGGCTTTGGG -3'

Sequencing Primer
(F):5'- CTAGCAGCCGAGAGACAGC -3'
(R):5'- CTGAACGGCTTTGGGGATGAG -3'
Posted On2017-10-10