Mutagenetix > Incidental Mutation

Incidental Mutation 'R6161:Sra1'

489897

Institutional Source

Beutler Lab

Gene Symbol

Sra1

Ensembl Gene

ENSMUSG00000006050

Gene Name

steroid receptor RNA activator 1

Synonyms

Srap

MMRRC Submission

044308-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6161 (G1)

Quality Score

190.009

Status

Validated

Chromosome

Chromosomal Location

36666681-36679366 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36670283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 9 (A9V)

Ref Sequence

ENSEMBL: ENSMUSP00000133360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036765] [ENSMUST00000142977] [ENSMUST00000173875]

AlphaFold

Q80VJ2

PDB Structure

Solution structure of mouse Steroid receptor RNA activator 1 (SRA1) protein [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000001415

SMART Domains

Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

Domain	Start	End	E-Value	Type
WW	30	61	1.72e-7	SMART
low complexity region	85	100	N/A	INTRINSIC
PTB	114	260	7.64e-37	SMART
PTB	286	420	4.07e-32	SMART
low complexity region	444	468	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000006209
AA Change: A1V

SMART Domains

Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050
AA Change: A1V

Domain	Start	End	E-Value	Type
Pfam:SRA1	65	208	1e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000036765

SMART Domains

Protein: ENSMUSP00000039298
Gene: ENSMUSG00000090264

Domain	Start	End	E-Value	Type
Pfam:eIF_4EBP	3	101	4.8e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140061

SMART Domains

Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	77	94	N/A	INTRINSIC
low complexity region	355	375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142977

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173202

Predicted Effect

unknown
Transcript: ENSMUST00000173482
AA Change: A1V

Predicted Effect

probably damaging
Transcript: ENSMUST00000173875
AA Change: A9V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050
AA Change: A9V

Domain	Start	End	E-Value	Type
Pfam:SRA1	72	217	1.1e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174125

Meta Mutation Damage Score

0.3427

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Sra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Sra1	APN	18	36668739	missense	probably benign	0.36
IGL01390:Sra1	APN	18	36670081	missense	probably damaging	1.00
IGL01645:Sra1	APN	18	36671473	missense	probably damaging	1.00
IGL02478:Sra1	APN	18	36668792	missense	probably benign	0.00
IGL02578:Sra1	APN	18	36670097	nonsense	probably null
R0218:Sra1	UTSW	18	36676609	unclassified	probably benign
R0243:Sra1	UTSW	18	36675706	nonsense	probably null
R0432:Sra1	UTSW	18	36677503	missense	probably benign
R0834:Sra1	UTSW	18	36668776	missense	probably benign	0.00
R1886:Sra1	UTSW	18	36668777	missense	probably benign
R2105:Sra1	UTSW	18	36675068	missense	probably benign	0.00
R2911:Sra1	UTSW	18	36676185	missense	possibly damaging	0.49
R4951:Sra1	UTSW	18	36676441	nonsense	probably null
R5034:Sra1	UTSW	18	36678995	critical splice donor site	probably null
R5091:Sra1	UTSW	18	36669959	intron	probably benign
R5122:Sra1	UTSW	18	36667594	missense	probably benign	0.03
R5656:Sra1	UTSW	18	36678407	missense	probably damaging	0.99
R5722:Sra1	UTSW	18	36674978	missense	probably damaging	1.00
R5726:Sra1	UTSW	18	36670173	intron	probably benign
R5729:Sra1	UTSW	18	36667443	utr 3 prime	probably benign
R5937:Sra1	UTSW	18	36671599	splice site	probably null
R6145:Sra1	UTSW	18	36667575	missense	probably damaging	1.00
R7423:Sra1	UTSW	18	36667483	missense	probably benign	0.00
R8074:Sra1	UTSW	18	36675011	missense	possibly damaging	0.89
R8100:Sra1	UTSW	18	36676895	missense	probably damaging	1.00
R8483:Sra1	UTSW	18	36667826	missense	probably benign
R9040:Sra1	UTSW	18	36675737	missense	probably damaging	1.00
R9044:Sra1	UTSW	18	36667893	missense	probably benign	0.00
R9428:Sra1	UTSW	18	36677246	missense	probably damaging	1.00
Z1176:Sra1	UTSW	18	36670009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTTAGTAAGGGGAGTGCG -3'
(R):5'- TTTGCTTCTGAGAGCAAACAAGG -3'

Sequencing Primer
(F):5'- AGTCTGAGTCTGGAGCCCGTAG -3'
(R):5'- CTGAGAGCAAACAAGGAGACATTTAG -3'

Posted On

2017-10-10