Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Mc4r'

489898

Institutional Source

Beutler Lab

Gene Symbol

Mc4r

Ensembl Gene

ENSMUSG00000047259

Gene Name

melanocortin 4 receptor

Synonyms

Fatboy

MMRRC Submission

044308-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66857715-66860472 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 66859180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 287 (Y287*)

Ref Sequence

ENSEMBL: ENSMUSP00000054776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057942]

AlphaFold

P56450

Predicted Effect

probably null
Transcript: ENSMUST00000057942
AA Change: Y287*

SMART Domains

Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: Y287*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	51	228	8.1e-11	PFAM
Pfam:7TM_GPCR_Srsx	55	317	6e-12	PFAM
Pfam:7tm_1	61	302	2.7e-31	PFAM

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Mc4r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01340:Mc4r	APN	18	66859158	missense	probably benign	0.01
IGL01382:Mc4r	APN	18	66859793	missense	probably damaging	0.96
IGL01820:Mc4r	APN	18	66859155	missense	probably benign	0.00
IGL02749:Mc4r	APN	18	66859662	missense	probably damaging	1.00
IGL02812:Mc4r	APN	18	66859247	missense	probably damaging	1.00
IGL03403:Mc4r	APN	18	66859526	missense	possibly damaging	0.61
Big_boned	UTSW	18	66859488	missense	probably damaging	1.00
Big_mac	UTSW	18	66859856	missense	probably damaging	1.00
blubbery	UTSW	18	66859182	missense	probably damaging	1.00
Cetacean	UTSW	18	66859180	nonsense	probably null
chubby	UTSW	18	66859847	missense	probably damaging	1.00
halloween	UTSW	18	66859821	missense	probably damaging	1.00
Leviathan	UTSW	18	66860039	start codon destroyed	probably null	0.49
southbeach	UTSW	18	66859142	missense	probably damaging	1.00
R1552:Mc4r	UTSW	18	66859695	missense	probably benign	0.00
R1623:Mc4r	UTSW	18	66859997	missense	probably benign	0.03
R1666:Mc4r	UTSW	18	66859409	missense	probably damaging	1.00
R1668:Mc4r	UTSW	18	66859409	missense	probably damaging	1.00
R1781:Mc4r	UTSW	18	66859847	missense	probably damaging	1.00
R1873:Mc4r	UTSW	18	66859460	missense	probably damaging	1.00
R2105:Mc4r	UTSW	18	66859598	missense	probably damaging	1.00
R2210:Mc4r	UTSW	18	66859395	missense	probably damaging	1.00
R3714:Mc4r	UTSW	18	66859821	missense	probably damaging	1.00
R3715:Mc4r	UTSW	18	66859821	missense	probably damaging	1.00
R4115:Mc4r	UTSW	18	66859979	missense	probably benign
R4322:Mc4r	UTSW	18	66859050	missense	probably benign	0.00
R4492:Mc4r	UTSW	18	66859640	missense	probably benign	0.00
R4806:Mc4r	UTSW	18	66859488	missense	probably damaging	1.00
R4877:Mc4r	UTSW	18	66859338	missense	probably benign	0.00
R6802:Mc4r	UTSW	18	66859417	missense	probably benign	0.21
R6807:Mc4r	UTSW	18	66859856	missense	probably damaging	1.00
R6929:Mc4r	UTSW	18	66859182	missense	probably damaging	1.00
R7623:Mc4r	UTSW	18	66859509	missense	probably benign	0.32
R8292:Mc4r	UTSW	18	66860011	nonsense	probably null
R8560:Mc4r	UTSW	18	66859095	missense	possibly damaging	0.60
R8897:Mc4r	UTSW	18	66859233	missense	probably damaging	0.99
R8943:Mc4r	UTSW	18	66860039	start codon destroyed	probably null	0.49

Predicted Primers

PCR Primer
(F):5'- ACAAAGTCTGCAGGTATCTACC -3'
(R):5'- ACATGTTCCTGATGGCGAGG -3'

Sequencing Primer
(F):5'- GGTATCTACCTAGTTTGCACTCTG -3'
(R):5'- GCTTCACATTAAGAGGATTGCTGTCC -3'

Posted On

2017-10-10