Incidental Mutation 'R6161:Mc4r'
ID 489898
Institutional Source Beutler Lab
Gene Symbol Mc4r
Ensembl Gene ENSMUSG00000047259
Gene Name melanocortin 4 receptor
Synonyms Fatboy
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 66857715-66860472 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 66859180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 287 (Y287*)
Ref Sequence ENSEMBL: ENSMUSP00000054776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057942]
AlphaFold P56450
Predicted Effect probably null
Transcript: ENSMUST00000057942
AA Change: Y287*
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: Y287*

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Mc4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
Big_mac UTSW 18 66859856 missense probably damaging 1.00
blubbery UTSW 18 66859182 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense probably null
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
Leviathan UTSW 18 66860039 start codon destroyed probably null 0.49
southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6807:Mc4r UTSW 18 66859856 missense probably damaging 1.00
R6929:Mc4r UTSW 18 66859182 missense probably damaging 1.00
R7623:Mc4r UTSW 18 66859509 missense probably benign 0.32
R8292:Mc4r UTSW 18 66860011 nonsense probably null
R8560:Mc4r UTSW 18 66859095 missense possibly damaging 0.60
R8897:Mc4r UTSW 18 66859233 missense probably damaging 0.99
R8943:Mc4r UTSW 18 66860039 start codon destroyed probably null 0.49
Predicted Primers PCR Primer
(F):5'- ACAAAGTCTGCAGGTATCTACC -3'
(R):5'- ACATGTTCCTGATGGCGAGG -3'

Sequencing Primer
(F):5'- GGTATCTACCTAGTTTGCACTCTG -3'
(R):5'- GCTTCACATTAAGAGGATTGCTGTCC -3'
Posted On 2017-10-10