Incidental Mutation 'R6161:Slc22a26'
ID 489899
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Name solute carrier family 22 (organic cation transporter), member 26
Synonyms BC014805
MMRRC Submission 044308-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6161 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 7758406-7780032 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7763812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 406 (I406K)
Ref Sequence ENSEMBL: ENSMUSP00000113607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
AlphaFold Q91WJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000065634
AA Change: I407K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: I407K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120522
AA Change: I406K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: I406K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,139,934 (GRCm39) K1533M probably damaging Het
Aldh1l2 C T 10: 83,356,202 (GRCm39) V63I probably benign Het
Atr A G 9: 95,747,372 (GRCm39) H218R probably benign Het
Atxn7l1 T A 12: 33,408,662 (GRCm39) S275T possibly damaging Het
Cacna1c T C 6: 119,034,263 (GRCm39) K88R probably damaging Het
Ccl7 T C 11: 81,937,412 (GRCm39) Y49H probably damaging Het
Cers5 A G 15: 99,636,544 (GRCm39) probably null Het
Chuk T C 19: 44,071,076 (GRCm39) E543G probably damaging Het
Dip2c T C 13: 9,697,043 (GRCm39) V1318A probably damaging Het
Ercc5 A G 1: 44,206,512 (GRCm39) H475R probably benign Het
Fat3 A G 9: 16,288,818 (GRCm39) L235P probably damaging Het
Fbn1 A T 2: 125,211,721 (GRCm39) C892* probably null Het
Fbxw8 T C 5: 118,230,740 (GRCm39) T354A possibly damaging Het
Fsip2 A C 2: 82,817,601 (GRCm39) T4445P possibly damaging Het
Gpld1 A T 13: 25,155,397 (GRCm39) Q344L probably benign Het
Hao1 A T 2: 134,347,545 (GRCm39) D253E probably benign Het
Hmcn2 A G 2: 31,246,266 (GRCm39) D745G probably benign Het
Kcnt1 A G 2: 25,793,397 (GRCm39) T658A probably benign Het
Klhl35 A G 7: 99,122,544 (GRCm39) probably benign Het
Lnx2 C T 5: 146,978,836 (GRCm39) probably null Het
Map3k5 T C 10: 19,876,321 (GRCm39) V160A probably damaging Het
Masp2 A T 4: 148,698,469 (GRCm39) I517F possibly damaging Het
Mc4r A T 18: 66,992,251 (GRCm39) Y287* probably null Het
Mthfr A G 4: 148,126,211 (GRCm39) D94G probably benign Het
Muc16 A G 9: 18,559,114 (GRCm39) I2393T unknown Het
Mybbp1a G T 11: 72,336,838 (GRCm39) V557L probably damaging Het
Mycbp2 A T 14: 103,536,183 (GRCm39) W256R probably damaging Het
Nacad G A 11: 6,550,902 (GRCm39) S763L probably benign Het
Nebl A G 2: 17,735,641 (GRCm39) V11A probably benign Het
Notch1 A T 2: 26,358,743 (GRCm39) C1363S probably damaging Het
Nphp3 A G 9: 103,909,105 (GRCm39) N772D probably benign Het
Nqo2 G A 13: 34,163,634 (GRCm39) V98M probably damaging Het
Pak4 A G 7: 28,264,692 (GRCm39) I70T possibly damaging Het
Pbx2 A G 17: 34,812,574 (GRCm39) K2E probably damaging Het
Pikfyve A G 1: 65,255,202 (GRCm39) T352A probably benign Het
Polr1g G A 7: 19,091,558 (GRCm39) T183I possibly damaging Het
Pop1 T C 15: 34,526,456 (GRCm39) Y684H probably damaging Het
Rpa1 A G 11: 75,205,721 (GRCm39) V212A probably damaging Het
Rpap2 A G 5: 107,768,536 (GRCm39) E458G probably damaging Het
Sin3a T C 9: 57,002,708 (GRCm39) V200A possibly damaging Het
Sla T C 15: 66,654,447 (GRCm39) T280A probably null Het
Slc24a1 T C 9: 64,844,545 (GRCm39) N606S unknown Het
Slc39a10 G A 1: 46,866,567 (GRCm39) T443M probably damaging Het
Smg1 A T 7: 117,762,553 (GRCm39) probably benign Het
Sra1 G A 18: 36,803,336 (GRCm39) A9V probably damaging Het
Stard4 A G 18: 33,342,109 (GRCm39) V47A probably damaging Het
Stat4 A T 1: 52,113,836 (GRCm39) D182V possibly damaging Het
Syt1 A G 10: 108,467,668 (GRCm39) F210L probably damaging Het
Ube2q1 T A 3: 89,688,667 (GRCm39) probably null Het
Vmn1r159 C T 7: 22,542,612 (GRCm39) C140Y possibly damaging Het
Wnt8a T C 18: 34,678,599 (GRCm39) F138L possibly damaging Het
Zfp623 T A 15: 75,820,470 (GRCm39) D475E probably benign Het
Zfp646 C T 7: 127,477,897 (GRCm39) R25W probably damaging Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7,760,201 (GRCm39) missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7,760,340 (GRCm39) missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7,767,527 (GRCm39) missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7,767,464 (GRCm39) missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7,779,549 (GRCm39) missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7,768,125 (GRCm39) critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7,765,613 (GRCm39) missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7,768,470 (GRCm39) missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7,779,466 (GRCm39) missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7,779,618 (GRCm39) missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7,765,575 (GRCm39) critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7,773,509 (GRCm39) splice site probably benign
R2156:Slc22a26 UTSW 19 7,779,480 (GRCm39) missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7,765,694 (GRCm39) critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7,767,500 (GRCm39) missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7,768,419 (GRCm39) missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7,779,546 (GRCm39) missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7,767,540 (GRCm39) missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7,767,540 (GRCm39) missense possibly damaging 0.62
R6494:Slc22a26 UTSW 19 7,779,651 (GRCm39) missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7,779,865 (GRCm39) start gained probably benign
R6724:Slc22a26 UTSW 19 7,779,726 (GRCm39) missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7,768,259 (GRCm39) missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7,760,509 (GRCm39) splice site probably null
R7558:Slc22a26 UTSW 19 7,762,651 (GRCm39) missense possibly damaging 0.94
R7634:Slc22a26 UTSW 19 7,779,952 (GRCm39) splice site probably null
R8772:Slc22a26 UTSW 19 7,767,477 (GRCm39) missense probably benign 0.27
R8905:Slc22a26 UTSW 19 7,760,331 (GRCm39) missense probably damaging 0.97
R8937:Slc22a26 UTSW 19 7,768,390 (GRCm39) splice site probably benign
R9059:Slc22a26 UTSW 19 7,762,559 (GRCm39) missense probably benign 0.01
R9659:Slc22a26 UTSW 19 7,763,798 (GRCm39) missense probably benign 0.02
R9788:Slc22a26 UTSW 19 7,763,798 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAAACTTACTAGCTTTTGGC -3'
(R):5'- AGCATATGATGTGAGTCACCTC -3'

Sequencing Primer
(F):5'- CAACATGTGAGTGGAAGACTGTTTTC -3'
(R):5'- GCATATGATGTGAGTCACCTCTTTGC -3'
Posted On 2017-10-10