Incidental Mutation 'R6161:Slc22a26'
ID489899
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Namesolute carrier family 22 (organic cation transporter), member 26
SynonymsBC014805
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7781041-7802667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7786447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 406 (I406K)
Ref Sequence ENSEMBL: ENSMUSP00000113607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065634
AA Change: I407K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: I407K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120522
AA Change: I406K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: I406K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7782836 missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7782975 missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7790162 missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7790099 missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7802184 missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7790760 critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7788248 missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7791105 missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7802101 missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7802253 missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7788210 critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7796144 splice site probably benign
R2156:Slc22a26 UTSW 19 7802115 missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7788329 critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7790135 missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7791054 missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7802181 missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R6494:Slc22a26 UTSW 19 7802286 missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7802500 start gained probably benign
R6724:Slc22a26 UTSW 19 7802361 missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7790894 missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7783144 intron probably null
R7558:Slc22a26 UTSW 19 7785286 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCAAACTTACTAGCTTTTGGC -3'
(R):5'- AGCATATGATGTGAGTCACCTC -3'

Sequencing Primer
(F):5'- CAACATGTGAGTGGAAGACTGTTTTC -3'
(R):5'- GCATATGATGTGAGTCACCTCTTTGC -3'
Posted On2017-10-10