Incidental Mutation 'R6162:Aox3'
ID489903
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 044309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6162 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58159731 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 695 (D695V)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040999
AA Change: D695V

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: D695V

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158650
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
Adh4 T A 3: 138,415,489 probably null Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Gprc6a T A 10: 51,614,912 I739F probably benign Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Lmf1 A G 17: 25,612,394 I205V probably benign Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Vmn2r12 A G 5: 109,086,564 L594P probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGACCTTCTTCCTGCCTGG -3'
(R):5'- GAGGACCCGTTTCCAATCAG -3'

Sequencing Primer
(F):5'- GTTAACAAGGACCTGGCAGCTTC -3'
(R):5'- GGACCCGTTTCCAATCAGAAGTATC -3'
Posted On2017-10-10