Mutagenetix > Incidental Mutations

Incidental Mutation 'R6162:Aox3'

489903

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

MMRRC Submission

044309-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6162 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58159731 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 695 (D695V)

Ref Sequence

ENSEMBL: ENSMUSP00000049391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999]

PDB Structure

Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040999
AA Change: D695V

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: D695V

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158650

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,309,047	C2924W	probably damaging	Het
Adh4	T	A	3: 138,415,489		probably null	Het
AI464131	A	G	4: 41,497,899	V577A	possibly damaging	Het
Ccnj	A	G	19: 40,845,162	Y221C	probably damaging	Het
Cct2	T	A	10: 117,058,186	D221V	probably damaging	Het
Cd5	G	A	19: 10,725,880	T138M	probably damaging	Het
Cep78	A	T	19: 15,974,940	M307K	probably benign	Het
Dclk1	C	A	3: 55,256,154	D222E	probably benign	Het
Dhrs11	C	T	11: 84,828,779	G40D	probably damaging	Het
Dnah10	A	G	5: 124,823,318	S3823G	probably benign	Het
Dock3	A	T	9: 106,964,799	Y944N	possibly damaging	Het
Dst	A	G	1: 34,006,237	D17G	probably damaging	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Fam20a	G	T	11: 109,682,870	S229*	probably null	Het
Fbn1	T	C	2: 125,360,227	D1242G	probably damaging	Het
Ggt5	T	A	10: 75,589,792	V28D	possibly damaging	Het
Gimap4	A	T	6: 48,690,721	I137F	probably damaging	Het
Git2	T	A	5: 114,761,656	H212L	probably damaging	Het
Gprc6a	T	A	10: 51,614,912	I739F	probably benign	Het
Il1rl2	A	G	1: 40,351,878	Y327C	probably damaging	Het
Lmf1	A	G	17: 25,612,394	I205V	probably benign	Het
Mipep	C	A	14: 60,787,404	P98Q	probably damaging	Het
Mroh2b	A	G	15: 4,915,225	D436G	probably damaging	Het
Notch1	C	T	2: 26,462,195	V2035I	probably benign	Het
Olfr1223	G	T	2: 89,144,770	F84L	probably benign	Het
Olfr388-ps1	T	A	11: 73,724,887	I46F	probably damaging	Het
Olfr698	A	T	7: 106,753,020	Y123N	probably damaging	Het
Oxa1l	A	G	14: 54,368,332	T395A	probably damaging	Het
Phospho2	T	A	2: 69,796,031	I177K	probably damaging	Het
Prpf40a	T	C	2: 53,159,305	T224A	probably benign	Het
Reln	T	A	5: 21,911,050	T2987S	probably damaging	Het
Scn5a	T	A	9: 119,522,555	I787F	probably damaging	Het
Sgsm2	A	T	11: 74,892,021	D36E	probably damaging	Het
Slc12a3	A	G	8: 94,345,773		probably null	Het
Soga1	T	A	2: 157,039,864	E756V	possibly damaging	Het
Tas2r134	T	C	2: 51,627,559	S17P	probably damaging	Het
Top3a	T	C	11: 60,745,937	Y609C	probably damaging	Het
Trem2	A	G	17: 48,348,666	I84V	probably damaging	Het
Vmn2r12	A	G	5: 109,086,564	L594P	probably damaging	Het
Wdr63	T	A	3: 146,044,862	I821F	probably damaging	Het
Zdbf2	A	T	1: 63,280,818		probably benign	Het
Zfr	C	T	15: 12,146,245	A294V	unknown	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R1984:Aox3	UTSW	1	58153061	missense	possibly damaging	0.88
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2385:Aox3	UTSW	1	58138289	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4200:Aox3	UTSW	1	58188378	missense	probably damaging	1.00
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5360:Aox3	UTSW	1	58146508	missense	probably damaging	1.00
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7116:Aox3	UTSW	1	58153530	missense	probably benign	0.01
R7146:Aox3	UTSW	1	58158529	splice site	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R7745:Aox3	UTSW	1	58176517	missense	possibly damaging	0.75
R7751:Aox3	UTSW	1	58179335	missense	probably benign	0.11
R7912:Aox3	UTSW	1	58142696	missense	probably benign	0.05
R7940:Aox3	UTSW	1	58188437	missense	probably damaging	1.00
R8143:Aox3	UTSW	1	58158915	missense	probably benign	0.05
R8178:Aox3	UTSW	1	58150322	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AAGACCTTCTTCCTGCCTGG -3'
(R):5'- GAGGACCCGTTTCCAATCAG -3'

Sequencing Primer
(F):5'- GTTAACAAGGACCTGGCAGCTTC -3'
(R):5'- GGACCCGTTTCCAATCAGAAGTATC -3'

Posted On

2017-10-10