Incidental Mutation 'R6162:Tas2r134'
ID489906
Institutional Source Beutler Lab
Gene Symbol Tas2r134
Ensembl Gene ENSMUSG00000056115
Gene Nametaste receptor, type 2, member 134
SynonymsT2R134, Tas2r34
MMRRC Submission 044309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6162 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location51627511-51628408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51627559 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 17 (S17P)
Ref Sequence ENSEMBL: ENSMUSP00000064657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070028]
Predicted Effect probably damaging
Transcript: ENSMUST00000070028
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064657
Gene: ENSMUSG00000056115
AA Change: S17P

DomainStartEndE-ValueType
Pfam:TAS2R 1 291 1.4e-75 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
Adh4 T A 3: 138,415,489 probably null Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Aox3 A T 1: 58,159,731 D695V possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Gprc6a T A 10: 51,614,912 I739F probably benign Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Lmf1 A G 17: 25,612,394 I205V probably benign Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Vmn2r12 A G 5: 109,086,564 L594P probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Tas2r134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL00563:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL01121:Tas2r134 APN 2 51627989 missense probably damaging 1.00
IGL01122:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01128:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01132:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01312:Tas2r134 APN 2 51628235 missense probably damaging 1.00
IGL01419:Tas2r134 APN 2 51627747 nonsense probably null
IGL01774:Tas2r134 APN 2 51628148 missense probably benign 0.07
IGL02735:Tas2r134 APN 2 51627827 missense probably damaging 1.00
R0799:Tas2r134 UTSW 2 51628373 missense probably benign 0.00
R1205:Tas2r134 UTSW 2 51627986 missense probably benign 0.00
R2267:Tas2r134 UTSW 2 51628237 missense probably benign 0.01
R3736:Tas2r134 UTSW 2 51627774 missense probably damaging 1.00
R5254:Tas2r134 UTSW 2 51627547 missense probably benign 0.39
R5752:Tas2r134 UTSW 2 51627868 missense probably damaging 1.00
R6940:Tas2r134 UTSW 2 51628136 missense probably benign 0.00
R6954:Tas2r134 UTSW 2 51627770 missense probably benign 0.00
R6996:Tas2r134 UTSW 2 51627589 missense probably benign 0.00
R7206:Tas2r134 UTSW 2 51628108 missense probably benign 0.02
R7303:Tas2r134 UTSW 2 51628133 missense probably benign 0.01
R7348:Tas2r134 UTSW 2 51628402 missense possibly damaging 0.92
R7479:Tas2r134 UTSW 2 51627529 missense not run
R7575:Tas2r134 UTSW 2 51628154 missense probably damaging 1.00
R7686:Tas2r134 UTSW 2 51628243 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GGATTCAGCAAGGTGATTGGC -3'
(R):5'- AACCAGAAATTGACAGTGTTGG -3'

Sequencing Primer
(F):5'- GGCTAAATAAATATGCTGTGCACCC -3'
(R):5'- AAATTGACAGTGTTGGTGAAGTCCC -3'
Posted On2017-10-10