Incidental Mutation 'R6162:Gprc6a'
ID489924
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 044309-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6162 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51614912 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 739 (I739F)
Ref Sequence ENSEMBL: ENSMUSP00000152031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: I914F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: I914F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: I739F

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: I843F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
Adh4 T A 3: 138,415,489 probably null Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Aox3 A T 1: 58,159,731 D695V possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Lmf1 A G 17: 25,612,394 I205V probably benign Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Vmn2r12 A G 5: 109,086,564 L594P probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTAAACAGTGTTCAAGCAAATGGC -3'
(R):5'- ACTACTCTGCTCACAGTGTGGAC -3'

Sequencing Primer
(F):5'- GCTGGGAAAGTAAATACACA -3'
(R):5'- GACAGCCTTGCCTTGAGTCATG -3'
Posted On2017-10-10