Mutagenetix > Incidental Mutation

Incidental Mutation 'R6162:Ggt5'

489925

Institutional Source

Beutler Lab

Gene Symbol

Ggt5

Ensembl Gene

ENSMUSG00000006344

Gene Name

gamma-glutamyltransferase 5

Synonyms

GGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase

MMRRC Submission

044309-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6162 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75589340-75617200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75589792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 28 (V28D)

Ref Sequence

ENSEMBL: ENSMUSP00000151283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000072217] [ENSMUST00000134503] [ENSMUST00000189972] [ENSMUST00000218807]

AlphaFold

Q9Z2A9

Predicted Effect

probably benign
Transcript: ENSMUST00000006508

SMART Domains

Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
Pfam:G_glu_transpept	54	563	4.9e-179	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000044101

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072217
AA Change: V28D

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: V28D

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:G_glu_transpept	58	568	1.6e-164	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129020

SMART Domains

Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345

Domain	Start	End	E-Value	Type
Pfam:G_glu_transpept	1	263	3.3e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134503

SMART Domains

Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
Pfam:G_glu_transpept	54	563	1.4e-184	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155186

SMART Domains

Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345

Domain	Start	End	E-Value	Type
Pfam:G_glu_transpept	1	128	6.3e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156487

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189972
AA Change: V28D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344
AA Change: V28D

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189991

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218807
AA Change: V28D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219247

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,309,047	C2924W	probably damaging	Het
Adh4	T	A	3: 138,415,489		probably null	Het
AI464131	A	G	4: 41,497,899	V577A	possibly damaging	Het
Aox3	A	T	1: 58,159,731	D695V	possibly damaging	Het
Ccnj	A	G	19: 40,845,162	Y221C	probably damaging	Het
Cct2	T	A	10: 117,058,186	D221V	probably damaging	Het
Cd5	G	A	19: 10,725,880	T138M	probably damaging	Het
Cep78	A	T	19: 15,974,940	M307K	probably benign	Het
Dclk1	C	A	3: 55,256,154	D222E	probably benign	Het
Dhrs11	C	T	11: 84,828,779	G40D	probably damaging	Het
Dnah10	A	G	5: 124,823,318	S3823G	probably benign	Het
Dock3	A	T	9: 106,964,799	Y944N	possibly damaging	Het
Dst	A	G	1: 34,006,237	D17G	probably damaging	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Fam20a	G	T	11: 109,682,870	S229*	probably null	Het
Fbn1	T	C	2: 125,360,227	D1242G	probably damaging	Het
Gimap4	A	T	6: 48,690,721	I137F	probably damaging	Het
Git2	T	A	5: 114,761,656	H212L	probably damaging	Het
Gprc6a	T	A	10: 51,614,912	I739F	probably benign	Het
Il1rl2	A	G	1: 40,351,878	Y327C	probably damaging	Het
Lmf1	A	G	17: 25,612,394	I205V	probably benign	Het
Mipep	C	A	14: 60,787,404	P98Q	probably damaging	Het
Mroh2b	A	G	15: 4,915,225	D436G	probably damaging	Het
Notch1	C	T	2: 26,462,195	V2035I	probably benign	Het
Olfr1223	G	T	2: 89,144,770	F84L	probably benign	Het
Olfr388-ps1	T	A	11: 73,724,887	I46F	probably damaging	Het
Olfr698	A	T	7: 106,753,020	Y123N	probably damaging	Het
Oxa1l	A	G	14: 54,368,332	T395A	probably damaging	Het
Phospho2	T	A	2: 69,796,031	I177K	probably damaging	Het
Prpf40a	T	C	2: 53,159,305	T224A	probably benign	Het
Reln	T	A	5: 21,911,050	T2987S	probably damaging	Het
Scn5a	T	A	9: 119,522,555	I787F	probably damaging	Het
Sgsm2	A	T	11: 74,892,021	D36E	probably damaging	Het
Slc12a3	A	G	8: 94,345,773		probably null	Het
Soga1	T	A	2: 157,039,864	E756V	possibly damaging	Het
Tas2r134	T	C	2: 51,627,559	S17P	probably damaging	Het
Top3a	T	C	11: 60,745,937	Y609C	probably damaging	Het
Trem2	A	G	17: 48,348,666	I84V	probably damaging	Het
Vmn2r12	A	G	5: 109,086,564	L594P	probably damaging	Het
Wdr63	T	A	3: 146,044,862	I821F	probably damaging	Het
Zdbf2	A	T	1: 63,280,818		probably benign	Het
Zfr	C	T	15: 12,146,245	A294V	unknown	Het

Other mutations in Ggt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01503:Ggt5	APN	10	75610110	splice site	probably benign
IGL01926:Ggt5	APN	10	75604101	missense	probably benign	0.00
IGL02095:Ggt5	APN	10	75608803	missense	probably benign	0.01
IGL02252:Ggt5	APN	10	75602732	missense	possibly damaging	0.51
IGL02393:Ggt5	APN	10	75610237	splice site	probably benign
IGL02515:Ggt5	APN	10	75589770	missense	probably benign	0.23
IGL02528:Ggt5	APN	10	75610420	splice site	probably benign
IGL02964:Ggt5	APN	10	75604128	missense	probably benign	0.08
R0646:Ggt5	UTSW	10	75602648	missense	probably damaging	0.99
R0834:Ggt5	UTSW	10	75604770	missense	possibly damaging	0.73
R1454:Ggt5	UTSW	10	75609908	missense	probably benign	0.01
R1650:Ggt5	UTSW	10	75604761	missense	probably benign	0.00
R1846:Ggt5	UTSW	10	75610542	splice site	probably null
R1896:Ggt5	UTSW	10	75604726	missense	probably damaging	1.00
R2044:Ggt5	UTSW	10	75604087	missense	probably damaging	0.97
R2357:Ggt5	UTSW	10	75609241	missense	probably benign	0.19
R3151:Ggt5	UTSW	10	75609242	missense	probably benign	0.35
R4667:Ggt5	UTSW	10	75603031	missense	probably damaging	1.00
R4669:Ggt5	UTSW	10	75603031	missense	probably damaging	1.00
R5060:Ggt5	UTSW	10	75604774	missense	probably benign
R5756:Ggt5	UTSW	10	75604773	missense	probably benign
R6156:Ggt5	UTSW	10	75609326	missense	probably damaging	1.00
R6900:Ggt5	UTSW	10	75610537	missense	possibly damaging	0.81
R8258:Ggt5	UTSW	10	75614832	missense	probably benign	0.04
R8259:Ggt5	UTSW	10	75614832	missense	probably benign	0.04
R9001:Ggt5	UTSW	10	75610158	missense	probably benign	0.21
R9510:Ggt5	UTSW	10	75609305	missense	probably benign
R9655:Ggt5	UTSW	10	75608801	missense	probably benign
Z1088:Ggt5	UTSW	10	75608759	missense	possibly damaging	0.81
Z1176:Ggt5	UTSW	10	75602618	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAGATCACCCTGTGTAGC -3'
(R):5'- CTGTTGTAGGAAGCCAAACCAC -3'

Sequencing Primer
(F):5'- GAGATCACCCTGTGTAGCTTCTTTTC -3'
(R):5'- GTTGTAGGAAGCCAAACCACACATG -3'

Posted On

2017-10-10