Incidental Mutation 'R6162:Lmf1'
ID489937
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
MMRRC Submission 044309-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6162 (G1)
Quality Score216.009
Status Validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25612394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 205 (I205V)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect probably benign
Transcript: ENSMUST00000063344
AA Change: I205V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: I205V

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116641
AA Change: I205V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: I205V

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128146
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect unknown
Transcript: ENSMUST00000154842
AA Change: I201V
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279
AA Change: I201V

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
Adh4 T A 3: 138,415,489 probably null Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Aox3 A T 1: 58,159,731 D695V possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Gprc6a T A 10: 51,614,912 I739F probably benign Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Vmn2r12 A G 5: 109,086,564 L594P probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGGTCAGGCTGAACTTGAGG -3'
(R):5'- AGGTAACCCCGATCCAGATGAG -3'

Sequencing Primer
(F):5'- CAGGCTGAACTTGAGGGTGATTC -3'
(R):5'- CAGATGAGCTGGCCCGG -3'
Posted On2017-10-10