Incidental Mutation 'R6163:Dlgap2'
ID489975
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6163 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14846641 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1039 (Q1039L)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably damaging
Transcript: ENSMUST00000043279
AA Change: Q1038L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: Q1038L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129119
Predicted Effect probably damaging
Transcript: ENSMUST00000133298
AA Change: Q1038L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: Q1038L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150247
AA Change: Q1024L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: Q1024L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152652
AA Change: Q1039L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: Q1039L

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GACCTTCTCTGACTTGTGATGC -3'
(R):5'- AATTGGAGCATCCGTCCACTG -3'

Sequencing Primer
(F):5'- CTTTTCAGGAAGAAAGGAAGATCCCC -3'
(R):5'- TGTCCACAGTGCAGAGAAC -3'
Posted On2017-10-10