Incidental Mutation 'R6163:Atad2b'
ID 489995
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6163 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4954593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 374 (L374H)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: L374H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: L374H

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTATGGGTCCAGAGATTC -3'
(R):5'- GGAAAAGACTTTACTAAGCAGCCC -3'

Sequencing Primer
(F):5'- CAGAGATTCTGTTCAGGTCCTCAG -3'
(R):5'- ACTAAGCAGCCCAGGTTTTG -3'
Posted On 2017-10-10