Incidental Mutation 'R6164:Sag'
ID490017
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene NameS-antigen, retina and pineal gland (arrestin)
Synonymsarrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87803680-87845158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87824453 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 223 (V223L)
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
Predicted Effect probably damaging
Transcript: ENSMUST00000077772
AA Change: V223L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: V223L

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect probably damaging
Transcript: ENSMUST00000177757
AA Change: V223L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: V223L

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Meta Mutation Damage Score 0.3516 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87824424 critical splice acceptor site probably null
IGL00822:Sag APN 1 87845026 splice site probably null
IGL01140:Sag APN 1 87823364 missense probably benign 0.22
IGL01612:Sag APN 1 87805349 missense probably damaging 0.98
IGL02183:Sag APN 1 87828475 splice site probably null
IGL02893:Sag APN 1 87834593 missense probably benign 0.01
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0091:Sag UTSW 1 87814680 missense probably damaging 0.96
R0531:Sag UTSW 1 87834629 critical splice donor site probably null
R0609:Sag UTSW 1 87812991 missense probably damaging 0.98
R1328:Sag UTSW 1 87810294 splice site probably benign
R1395:Sag UTSW 1 87828441 missense probably benign 0.01
R1748:Sag UTSW 1 87831940 missense probably damaging 1.00
R1858:Sag UTSW 1 87814848 missense probably benign
R2020:Sag UTSW 1 87805315 missense probably damaging 1.00
R3854:Sag UTSW 1 87824518 splice site probably benign
R4021:Sag UTSW 1 87821305 critical splice acceptor site probably null
R4298:Sag UTSW 1 87845015 missense probably benign
R4630:Sag UTSW 1 87834618 missense probably damaging 0.99
R5352:Sag UTSW 1 87812993 missense probably benign 0.01
R5680:Sag UTSW 1 87821337 missense possibly damaging 0.83
R6407:Sag UTSW 1 87814806 missense probably benign
R7431:Sag UTSW 1 87821337 missense possibly damaging 0.83
R7548:Sag UTSW 1 87844916 missense probably benign 0.01
R8122:Sag UTSW 1 87834567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGATGAGGCTGAACATG -3'
(R):5'- AGGCAGATCTAAGGGCACTG -3'

Sequencing Primer
(F):5'- AGGCTGAACATGTTGATAGCCTTC -3'
(R):5'- CAGATCTAAGGGCACTGTTGGG -3'
Posted On2017-10-10