Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Rnasel'

490020

Institutional Source

Beutler Lab

Gene Symbol

Rnasel

Ensembl Gene

ENSMUSG00000066800

Gene Name

ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)

Synonyms

2-5A-dependent RNAase, E230029I04Rik

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153749426-153764221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153754392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 218 (V218A)

Ref Sequence

ENSEMBL: ENSMUSP00000138247 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]

AlphaFold

Q05921

Predicted Effect

probably benign
Transcript: ENSMUST00000086209
AA Change: V218A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: V218A

Domain	Start	End	E-Value	Type
ANK	24	53	6.07e0	SMART
ANK	58	87	6.65e-6	SMART
ANK	91	120	2.73e-2	SMART
ANK	124	153	2.13e-4	SMART
ANK	167	197	6.36e-3	SMART
ANK	201	234	1.06e1	SMART
ANK	238	268	4.13e-2	SMART
ANK	272	301	7.3e-3	SMART
Pfam:Pkinase	365	521	4.9e-19	PFAM
Pfam:Pkinase_Tyr	365	523	6.1e-14	PFAM
Pfam:Kdo	451	546	8e-8	PFAM
PUG	656	707	2.33e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182016

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182131

Predicted Effect

probably benign
Transcript: ENSMUST00000182538

SMART Domains

Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800

Domain	Start	End	E-Value	Type
PUG	148	199	2.33e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182722
AA Change: V218A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800
AA Change: V218A

Domain	Start	End	E-Value	Type
ANK	24	53	6.07e0	SMART
ANK	58	87	6.65e-6	SMART
ANK	91	120	2.73e-2	SMART
ANK	124	153	2.13e-4	SMART
ANK	167	197	6.36e-3	SMART
ANK	201	234	1.06e1	SMART
ANK	238	268	4.13e-2	SMART
ANK	272	301	7.3e-3	SMART
Pfam:Pkinase_Tyr	364	523	2.4e-13	PFAM
Pfam:Pkinase	365	520	2.1e-18	PFAM
Pfam:Kdo	452	546	9.3e-7	PFAM
Pfam:Ribonuc_2-5A	589	651	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183241
AA Change: V218A

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800
AA Change: V218A

Domain	Start	End	E-Value	Type
ANK	24	53	6.07e0	SMART
ANK	58	87	6.65e-6	SMART
ANK	91	120	2.73e-2	SMART
ANK	124	153	2.13e-4	SMART
ANK	167	197	6.36e-3	SMART
ANK	201	234	1.06e1	SMART
ANK	238	268	4.13e-2	SMART
ANK	272	301	7.3e-3	SMART
Pfam:Pkinase_Tyr	364	523	2.6e-13	PFAM
Pfam:Pkinase	365	517	2.4e-18	PFAM
Pfam:Kdo	452	546	9.7e-7	PFAM
Pfam:Ribonuc_2-5A	589	674	1.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187415

Meta Mutation Damage Score

0.2046

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Rnasel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01285:Rnasel	APN	1	153758384	missense	probably benign	0.04
IGL02662:Rnasel	APN	1	153754111	missense	probably damaging	1.00
IGL03215:Rnasel	APN	1	153758555	missense	probably damaging	1.00
R0022:Rnasel	UTSW	1	153760775	missense	probably damaging	1.00
R0022:Rnasel	UTSW	1	153760775	missense	probably damaging	1.00
R0028:Rnasel	UTSW	1	153754719	missense	probably benign	0.04
R0116:Rnasel	UTSW	1	153754512	missense	probably damaging	1.00
R0981:Rnasel	UTSW	1	153759599	missense	probably benign	0.03
R1523:Rnasel	UTSW	1	153756013	missense	probably damaging	0.98
R1538:Rnasel	UTSW	1	153760794	missense	possibly damaging	0.62
R1646:Rnasel	UTSW	1	153755054	missense	probably damaging	1.00
R1793:Rnasel	UTSW	1	153754423	missense	probably damaging	0.98
R1843:Rnasel	UTSW	1	153754674	missense	possibly damaging	0.94
R2158:Rnasel	UTSW	1	153754901	missense	probably damaging	1.00
R2434:Rnasel	UTSW	1	153754650	missense	probably damaging	1.00
R2895:Rnasel	UTSW	1	153760776	missense	probably damaging	1.00
R4107:Rnasel	UTSW	1	153754796	missense	probably benign	0.00
R5013:Rnasel	UTSW	1	153753931	missense	probably damaging	0.99
R5015:Rnasel	UTSW	1	153754097	nonsense	probably null
R5540:Rnasel	UTSW	1	153755144	nonsense	probably null
R5688:Rnasel	UTSW	1	153753706	start gained	probably benign
R5955:Rnasel	UTSW	1	153754400	missense	probably benign	0.05
R6131:Rnasel	UTSW	1	153754460	missense	probably damaging	1.00
R6395:Rnasel	UTSW	1	153762121	missense	probably damaging	0.99
R6483:Rnasel	UTSW	1	153754686	missense	probably benign	0.10
R7470:Rnasel	UTSW	1	153754031	missense	probably benign	0.00
R7538:Rnasel	UTSW	1	153754560	missense	probably benign	0.03
R8310:Rnasel	UTSW	1	153754988	missense	possibly damaging	0.87
R8804:Rnasel	UTSW	1	153753915	missense	probably damaging	1.00
R8813:Rnasel	UTSW	1	153753895	missense	probably damaging	1.00
R8947:Rnasel	UTSW	1	153755031	missense	probably damaging	1.00
R9239:Rnasel	UTSW	1	153754351	missense	probably damaging	1.00
R9552:Rnasel	UTSW	1	153754927	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAGGGAGCCAATGTGAATTTGC -3'
(R):5'- GCAATTAGCAGAGCTGTCTTG -3'

Sequencing Primer
(F):5'- CCAATGTGAATTTGCGACGAC -3'
(R):5'- AATTAGCAGAGCTGTCTTGCCCTC -3'

Posted On

2017-10-10