Incidental Mutation 'R6164:Myo3b'
ID 490024
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 70075754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000060208] [ENSMUST00000112243] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably null
Transcript: ENSMUST00000060208
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060208
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112243
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112243
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anpep A G 7: 79,491,953 (GRCm39) I16T possibly damaging Het
Ap1s1 T C 5: 137,066,240 (GRCm39) probably benign Het
Atp1a2 T C 1: 172,106,459 (GRCm39) S848G probably damaging Het
Bche T A 3: 73,608,389 (GRCm39) I346F possibly damaging Het
Ccdc148 T A 2: 58,713,645 (GRCm39) Y502F probably damaging Het
Ccdc88c T C 12: 100,919,642 (GRCm39) M416V probably damaging Het
Cdk17 T C 10: 93,071,331 (GRCm39) S351P probably benign Het
Cfap100 T C 6: 90,392,768 (GRCm39) E114G probably benign Het
Clec4a4 T C 6: 122,968,833 (GRCm39) I66T possibly damaging Het
Cpeb4 T C 11: 31,870,584 (GRCm39) probably null Het
Cybrd1 T C 2: 70,948,618 (GRCm39) V52A probably damaging Het
Decr1 G A 4: 15,924,347 (GRCm39) A191V probably benign Het
Dnah5 A T 15: 28,378,489 (GRCm39) I2942L probably benign Het
Ehd4 C T 2: 119,932,689 (GRCm39) V246I possibly damaging Het
Ercc6l2 A G 13: 64,020,158 (GRCm39) probably benign Het
Exoc4 T A 6: 33,309,218 (GRCm39) M280K probably damaging Het
Fmo1 T G 1: 162,678,979 (GRCm39) E89A probably benign Het
Foxm1 A G 6: 128,350,898 (GRCm39) D733G probably benign Het
Garin5b T C 7: 4,773,677 (GRCm39) T73A probably damaging Het
Gulp1 A C 1: 44,793,511 (GRCm39) R57S probably damaging Het
Hdac1-ps T C 17: 78,799,716 (GRCm39) S236P probably damaging Het
Hdac4 G T 1: 91,957,876 (GRCm39) A46E probably benign Het
Hspg2 T C 4: 137,241,966 (GRCm39) S567P possibly damaging Het
Insyn1 C A 9: 58,406,530 (GRCm39) P147T probably damaging Het
Iqgap1 A C 7: 80,458,854 (GRCm39) C21W unknown Het
Isoc2a T C 7: 4,894,488 (GRCm39) L57P probably damaging Het
Krt34 G A 11: 99,929,272 (GRCm39) Q313* probably null Het
Krt6a C T 15: 101,601,008 (GRCm39) V263I probably damaging Het
Man2a1 A G 17: 65,040,719 (GRCm39) I106V possibly damaging Het
Muc16 T C 9: 18,469,675 (GRCm39) D7300G probably damaging Het
Muc5b A T 7: 141,417,082 (GRCm39) S3343C possibly damaging Het
Mup11 C T 4: 60,618,239 (GRCm39) E21K possibly damaging Het
Nlrp4c T C 7: 6,095,507 (GRCm39) L795P probably damaging Het
Nup160 T A 2: 90,548,220 (GRCm39) Y984* probably null Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or2d3 G T 7: 106,491,135 (GRCm39) Y60* probably null Het
Or5p52 A G 7: 107,502,595 (GRCm39) T224A probably benign Het
Osmr A G 15: 6,889,833 (GRCm39) V5A probably benign Het
Pabir1 T A 19: 24,454,450 (GRCm39) M91L probably benign Het
Pcsk5 A G 19: 17,814,317 (GRCm39) probably null Het
Pex11a G A 7: 79,387,127 (GRCm39) T235M probably damaging Het
Pik3r6 A G 11: 68,442,799 (GRCm39) T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 (GRCm39) probably benign Het
Ppp2r2d T C 7: 138,474,742 (GRCm39) I41T probably damaging Het
Prdm1 C T 10: 44,326,191 (GRCm39) R126H probably damaging Het
Primpol C T 8: 47,039,477 (GRCm39) R381H probably benign Het
Prl7a1 C A 13: 27,821,626 (GRCm39) Q102H probably benign Het
Rbpjl T C 2: 164,252,799 (GRCm39) L284P probably damaging Het
Rgs21 A T 1: 144,417,035 (GRCm39) C6S probably benign Het
Rnasel T C 1: 153,630,138 (GRCm39) V218A probably benign Het
Sag G T 1: 87,752,175 (GRCm39) V223L probably damaging Het
Sdk1 C T 5: 142,117,824 (GRCm39) T1574M probably damaging Het
Secisbp2 G A 13: 51,833,896 (GRCm39) V679M probably damaging Het
Sele T A 1: 163,879,386 (GRCm39) probably null Het
Senp7 T A 16: 55,990,117 (GRCm39) L622M probably damaging Het
Sgo1 G A 17: 53,983,981 (GRCm39) R466C probably damaging Het
Sh3tc1 C A 5: 35,863,590 (GRCm39) V866L probably benign Het
Snrnp25 T A 11: 32,157,647 (GRCm39) V75D probably benign Het
Syne1 C T 10: 5,011,429 (GRCm39) C7899Y probably damaging Het
U2af1l4 T C 7: 30,264,007 (GRCm39) S55P probably damaging Het
Vmn1r23 A G 6: 57,903,040 (GRCm39) I246T possibly damaging Het
Vmn1r66 T A 7: 10,008,329 (GRCm39) R235* probably null Het
Wnk4 C T 11: 101,165,894 (GRCm39) A807V possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGTATTAGCCTGTGAAGG -3'
(R):5'- CATGCATTTGAAAACTGTCCTGC -3'

Sequencing Primer
(F):5'- GGAAGAAACCCAGGTGTCCC -3'
(R):5'- TGAAAACTGTCCTGCAAGCTAG -3'
Posted On 2017-10-10