Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Nup160'

490026

Institutional Source

Beutler Lab

Gene Symbol

Nup160

Ensembl Gene

ENSMUSG00000051329

Gene Name

nucleoporin 160

Synonyms

Gtl1-13, 2810011M03Rik

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90677215-90736328 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 90717876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 984 (Y984*)

Ref Sequence

ENSEMBL: ENSMUSP00000059289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057481]

AlphaFold

Q9Z0W3

Predicted Effect

probably null
Transcript: ENSMUST00000057481
AA Change: Y984*

SMART Domains

Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: Y984*

Domain	Start	End	E-Value	Type
Pfam:Nup160	28	543	9.9e-134	PFAM
low complexity region	695	710	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1302	1315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132595

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Nup160

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Nup160	APN	2	90693106	missense	probably damaging	1.00
IGL00938:Nup160	APN	2	90732827	missense	probably damaging	1.00
IGL01111:Nup160	APN	2	90733209	missense	probably benign	0.00
IGL01140:Nup160	APN	2	90700565	missense	possibly damaging	0.85
IGL01348:Nup160	APN	2	90700428	missense	probably benign	0.05
IGL01361:Nup160	APN	2	90684012	nonsense	probably null
IGL01595:Nup160	APN	2	90729737	missense	probably damaging	1.00
IGL01791:Nup160	APN	2	90703853	missense	probably damaging	1.00
IGL02058:Nup160	APN	2	90729707	missense	probably damaging	1.00
IGL02147:Nup160	APN	2	90703941	missense	probably benign	0.17
IGL02250:Nup160	APN	2	90708870	missense	probably damaging	1.00
IGL02507:Nup160	APN	2	90729735	missense	probably benign	0.08
IGL03108:Nup160	APN	2	90703825	missense	probably benign
R0031:Nup160	UTSW	2	90717587	splice site	probably null
R0365:Nup160	UTSW	2	90708844	missense	probably benign	0.01
R0417:Nup160	UTSW	2	90735427	missense	possibly damaging	0.93
R0781:Nup160	UTSW	2	90733219	splice site	probably benign
R1037:Nup160	UTSW	2	90693902	missense	probably damaging	1.00
R1110:Nup160	UTSW	2	90733219	splice site	probably benign
R1459:Nup160	UTSW	2	90690150	missense	probably damaging	1.00
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1478:Nup160	UTSW	2	90679399	start gained	probably benign
R1565:Nup160	UTSW	2	90722061	missense	possibly damaging	0.62
R1617:Nup160	UTSW	2	90679499	missense	probably benign
R1647:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1648:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1702:Nup160	UTSW	2	90683958	missense	probably damaging	0.96
R1719:Nup160	UTSW	2	90700436	nonsense	probably null
R2448:Nup160	UTSW	2	90722057	missense	probably damaging	1.00
R3775:Nup160	UTSW	2	90722076	missense	probably benign
R3776:Nup160	UTSW	2	90722076	missense	probably benign
R4600:Nup160	UTSW	2	90685197	critical splice donor site	probably null
R4812:Nup160	UTSW	2	90725691	missense	probably damaging	1.00
R5075:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R5309:Nup160	UTSW	2	90732832	nonsense	probably null
R5312:Nup160	UTSW	2	90732832	nonsense	probably null
R5447:Nup160	UTSW	2	90725615	missense	possibly damaging	0.82
R5682:Nup160	UTSW	2	90679811	missense	probably benign	0.29
R5726:Nup160	UTSW	2	90717851	missense	probably damaging	1.00
R5771:Nup160	UTSW	2	90723396	missense	probably damaging	1.00
R5825:Nup160	UTSW	2	90679770	critical splice acceptor site	probably null
R5851:Nup160	UTSW	2	90707038	missense	probably benign
R5988:Nup160	UTSW	2	90689209	missense	probably damaging	1.00
R6151:Nup160	UTSW	2	90690105	nonsense	probably null
R6356:Nup160	UTSW	2	90711935	splice site	probably null
R6379:Nup160	UTSW	2	90702409	nonsense	probably null
R6519:Nup160	UTSW	2	90718217	missense	probably damaging	0.99
R6755:Nup160	UTSW	2	90700456	missense	probably damaging	1.00
R6989:Nup160	UTSW	2	90707020	missense	probably benign	0.34
R7251:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R7256:Nup160	UTSW	2	90723355	missense	probably damaging	1.00
R7353:Nup160	UTSW	2	90703952	missense	probably damaging	0.99
R7546:Nup160	UTSW	2	90685058	missense	probably damaging	1.00
R7761:Nup160	UTSW	2	90703112	missense	probably benign
R7768:Nup160	UTSW	2	90700116	missense	probably damaging	1.00
R7959:Nup160	UTSW	2	90713895	critical splice donor site	probably null
R8525:Nup160	UTSW	2	90718096	critical splice donor site	probably null
R8726:Nup160	UTSW	2	90733201	missense	possibly damaging	0.86
R8745:Nup160	UTSW	2	90700119	missense	probably benign	0.03
R8989:Nup160	UTSW	2	90717864	missense	probably damaging	1.00
R9087:Nup160	UTSW	2	90684085	missense	probably benign	0.09
R9147:Nup160	UTSW	2	90703145	missense	probably damaging	1.00
R9148:Nup160	UTSW	2	90703145	missense	probably damaging	1.00
R9149:Nup160	UTSW	2	90722241	intron	probably benign
R9153:Nup160	UTSW	2	90684085	missense	possibly damaging	0.78
R9284:Nup160	UTSW	2	90718031	missense	possibly damaging	0.94
R9435:Nup160	UTSW	2	90729794	missense	probably damaging	1.00
R9537:Nup160	UTSW	2	90729744	missense	possibly damaging	0.80
R9695:Nup160	UTSW	2	90708142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAAGCAGGTGATGACTGG -3'
(R):5'- AAGATCCTGCAGTTGGGAGC -3'

Sequencing Primer
(F):5'- CTGAAGCAGGTGATGACTGGAAAAG -3'
(R):5'- CAGTTGGGAGCGTTCACATAG -3'

Posted On

2017-10-10