Incidental Mutation 'R6164:Nup160'
ID490026
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Namenucleoporin 160
SynonymsGtl1-13, 2810011M03Rik
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90677215-90736328 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 90717876 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 984 (Y984*)
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
Predicted Effect probably null
Transcript: ENSMUST00000057481
AA Change: Y984*
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: Y984*

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132595
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90693106 missense probably damaging 1.00
IGL00938:Nup160 APN 2 90732827 missense probably damaging 1.00
IGL01111:Nup160 APN 2 90733209 missense probably benign 0.00
IGL01140:Nup160 APN 2 90700565 missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90700428 missense probably benign 0.05
IGL01361:Nup160 APN 2 90684012 nonsense probably null
IGL01595:Nup160 APN 2 90729737 missense probably damaging 1.00
IGL01791:Nup160 APN 2 90703853 missense probably damaging 1.00
IGL02058:Nup160 APN 2 90729707 missense probably damaging 1.00
IGL02147:Nup160 APN 2 90703941 missense probably benign 0.17
IGL02250:Nup160 APN 2 90708870 missense probably damaging 1.00
IGL02507:Nup160 APN 2 90729735 missense probably benign 0.08
IGL03108:Nup160 APN 2 90703825 missense probably benign
R0031:Nup160 UTSW 2 90717587 splice site probably null
R0365:Nup160 UTSW 2 90708844 missense probably benign 0.01
R0417:Nup160 UTSW 2 90735427 missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90733219 splice site probably benign
R1037:Nup160 UTSW 2 90693902 missense probably damaging 1.00
R1110:Nup160 UTSW 2 90733219 splice site probably benign
R1459:Nup160 UTSW 2 90690150 missense probably damaging 1.00
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1478:Nup160 UTSW 2 90679399 start gained probably benign
R1565:Nup160 UTSW 2 90722061 missense possibly damaging 0.62
R1617:Nup160 UTSW 2 90679499 missense probably benign
R1647:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1648:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1702:Nup160 UTSW 2 90683958 missense probably damaging 0.96
R1719:Nup160 UTSW 2 90700436 nonsense probably null
R2448:Nup160 UTSW 2 90722057 missense probably damaging 1.00
R3775:Nup160 UTSW 2 90722076 missense probably benign
R3776:Nup160 UTSW 2 90722076 missense probably benign
R4600:Nup160 UTSW 2 90685197 critical splice donor site probably null
R4812:Nup160 UTSW 2 90725691 missense probably damaging 1.00
R5075:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R5309:Nup160 UTSW 2 90732832 nonsense probably null
R5312:Nup160 UTSW 2 90732832 nonsense probably null
R5447:Nup160 UTSW 2 90725615 missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90679811 missense probably benign 0.29
R5726:Nup160 UTSW 2 90717851 missense probably damaging 1.00
R5771:Nup160 UTSW 2 90723396 missense probably damaging 1.00
R5825:Nup160 UTSW 2 90679770 critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90707038 missense probably benign
R5988:Nup160 UTSW 2 90689209 missense probably damaging 1.00
R6151:Nup160 UTSW 2 90690105 nonsense probably null
R6356:Nup160 UTSW 2 90711935 splice site probably null
R6379:Nup160 UTSW 2 90702409 nonsense probably null
R6519:Nup160 UTSW 2 90718217 missense probably damaging 0.99
R6755:Nup160 UTSW 2 90700456 missense probably damaging 1.00
R6989:Nup160 UTSW 2 90707020 missense probably benign 0.34
R7251:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R7256:Nup160 UTSW 2 90723355 missense probably damaging 1.00
R7353:Nup160 UTSW 2 90703952 missense probably damaging 0.99
R7546:Nup160 UTSW 2 90685058 missense probably damaging 1.00
R7761:Nup160 UTSW 2 90703112 missense probably benign
R7768:Nup160 UTSW 2 90700116 missense probably damaging 1.00
R7959:Nup160 UTSW 2 90713895 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGCAGGTGATGACTGG -3'
(R):5'- AAGATCCTGCAGTTGGGAGC -3'

Sequencing Primer
(F):5'- CTGAAGCAGGTGATGACTGGAAAAG -3'
(R):5'- CAGTTGGGAGCGTTCACATAG -3'
Posted On2017-10-10