Incidental Mutation 'R6164:Rbpjl'
ID490028
Institutional Source Beutler Lab
Gene Symbol Rbpjl
Ensembl Gene ENSMUSG00000017007
Gene Namerecombination signal binding protein for immunoglobulin kappa J region-like
SynonymsRBP-J kappa-like, Rbpsuhl, RBP-L
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164403141-164415448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164410879 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 284 (L284P)
Ref Sequence ENSEMBL: ENSMUSP00000017151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151]
Predicted Effect probably damaging
Transcript: ENSMUST00000017151
AA Change: L284P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007
AA Change: L284P

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Meta Mutation Damage Score 0.4896 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of hairless protein family. A similar protein in mouse is a transcription factor that binds to DNA sequences almost identical to that bound by the Notch receptor signaling pathway transcription factor recombining binding protein J. The mouse protein has been shown to activate transcription in concert with Epstein-Barr virus nuclear antigen-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene do not display any obvious phenotype abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Rbpjl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rbpjl APN 2 164407785 missense possibly damaging 0.74
IGL02429:Rbpjl APN 2 164413895 missense possibly damaging 0.80
R2155:Rbpjl UTSW 2 164414423 missense possibly damaging 0.80
R2244:Rbpjl UTSW 2 164403217 intron probably benign
R2344:Rbpjl UTSW 2 164414392 missense probably damaging 0.99
R4721:Rbpjl UTSW 2 164404527 missense probably benign 0.08
R5023:Rbpjl UTSW 2 164410289 missense probably damaging 1.00
R5492:Rbpjl UTSW 2 164414410 frame shift probably null
R5493:Rbpjl UTSW 2 164414410 frame shift probably null
R5494:Rbpjl UTSW 2 164414410 frame shift probably null
R5556:Rbpjl UTSW 2 164408062 missense probably benign 0.01
R5796:Rbpjl UTSW 2 164410248 splice site probably benign
R7609:Rbpjl UTSW 2 164405814 missense probably benign 0.05
R8025:Rbpjl UTSW 2 164410246 splice site probably benign
R8068:Rbpjl UTSW 2 164408518 missense possibly damaging 0.93
R8251:Rbpjl UTSW 2 164413934 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTCTCATGGCTAGCTGCG -3'
(R):5'- GGGATATGGGTTCATCCACATC -3'

Sequencing Primer
(F):5'- CGTTGTGCGTTAAAGCCAGAG -3'
(R):5'- TATGGGTTCATCCACATCAAGGAG -3'
Posted On2017-10-10