Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Hspg2'

490032

Institutional Source

Beutler Lab

Gene Symbol

Hspg2

Ensembl Gene

ENSMUSG00000028763

Gene Name

perlecan (heparan sulfate proteoglycan 2)

Synonyms

Plc, Pcn, per

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137468769-137570630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 137514655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 567 (S567P)

Ref Sequence

ENSEMBL: ENSMUSP00000131316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030547
AA Change: S567P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: S567P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1113	1156	7.5e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2056	2117	4.81e-15	SMART
IGc2	2157	2216	1.37e-10	SMART
IGc2	2251	2312	5.88e-10	SMART
low complexity region	2333	2344	N/A	INTRINSIC
IGc2	2347	2408	1.97e-11	SMART
IGc2	2441	2502	1.59e-15	SMART
low complexity region	2517	2528	N/A	INTRINSIC
IGc2	2538	2599	3.08e-13	SMART
IGc2	2634	2695	9.25e-17	SMART
low complexity region	2704	2728	N/A	INTRINSIC
IGc2	2731	2792	1.84e-11	SMART
IGc2	2828	2889	2.11e-11	SMART
IGc2	2926	2987	3.25e-12	SMART
IG	3017	3098	3.62e-10	SMART
IGc2	3114	3180	9.05e-11	SMART
IGc2	3212	3273	2.44e-16	SMART
IGc2	3299	3360	2.26e-11	SMART
IGc2	3400	3461	6.81e-6	SMART
IGc2	3489	3550	1.59e-15	SMART
IGc2	3575	3636	2.54e-14	SMART
LamG	3672	3813	3.41e-39	SMART
EGF	3832	3866	6.91e-9	SMART
EGF	3872	3907	4.46e-3	SMART
LamG	3934	4070	4.78e-43	SMART
EGF	4092	4126	1.17e-6	SMART
EGF	4131	4161	1.87e-5	SMART
LamG	4211	4348	1.33e-41	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171332
AA Change: S567P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: S567P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1114	1156	7.9e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2062	2123	4.81e-15	SMART
IGc2	2163	2222	1.37e-10	SMART
IGc2	2257	2318	5.88e-10	SMART
low complexity region	2339	2350	N/A	INTRINSIC
IGc2	2353	2414	1.97e-11	SMART
IGc2	2447	2508	1.59e-15	SMART
low complexity region	2523	2534	N/A	INTRINSIC
IGc2	2544	2605	3.08e-13	SMART
IGc2	2640	2701	9.25e-17	SMART
low complexity region	2710	2734	N/A	INTRINSIC
IGc2	2737	2798	1.84e-11	SMART
IGc2	2836	2897	2.11e-11	SMART
IGc2	2934	2995	3.25e-12	SMART
IG	3025	3106	3.62e-10	SMART
IGc2	3122	3188	9.05e-11	SMART
IGc2	3220	3281	2.44e-16	SMART
IGc2	3307	3368	2.26e-11	SMART
IGc2	3408	3469	6.81e-6	SMART
IGc2	3497	3558	1.59e-15	SMART
IGc2	3583	3644	2.54e-14	SMART
LamG	3680	3821	3.41e-39	SMART
EGF	3840	3874	6.91e-9	SMART
EGF	3880	3915	4.46e-3	SMART
LamG	3942	4078	4.78e-43	SMART
EGF	4100	4134	1.17e-6	SMART
EGF	4139	4169	1.87e-5	SMART
LamG	4219	4356	1.33e-41	SMART

Meta Mutation Damage Score

0.1036

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Hspg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hspg2	APN	4	137528820	missense	probably damaging	1.00
IGL00339:Hspg2	APN	4	137539195	missense	probably damaging	1.00
IGL00943:Hspg2	APN	4	137562201	missense	probably benign	0.15
IGL00970:Hspg2	APN	4	137542590	missense	probably benign	0.09
IGL01011:Hspg2	APN	4	137559335	missense	probably damaging	1.00
IGL01148:Hspg2	APN	4	137546658	missense	probably benign	0.11
IGL01333:Hspg2	APN	4	137540314	missense	probably damaging	1.00
IGL01367:Hspg2	APN	4	137538489	missense	probably damaging	1.00
IGL01455:Hspg2	APN	4	137553817	missense	probably damaging	1.00
IGL01540:Hspg2	APN	4	137519706	missense	probably damaging	1.00
IGL01578:Hspg2	APN	4	137539183	missense	probably damaging	1.00
IGL01603:Hspg2	APN	4	137552803	missense	probably damaging	1.00
IGL01632:Hspg2	APN	4	137514773	missense	probably damaging	1.00
IGL01658:Hspg2	APN	4	137564926	missense	probably damaging	1.00
IGL01760:Hspg2	APN	4	137512671	missense	possibly damaging	0.60
IGL01976:Hspg2	APN	4	137561926	missense	probably damaging	1.00
IGL02024:Hspg2	APN	4	137540073	missense	probably damaging	1.00
IGL02033:Hspg2	APN	4	137552254	missense	probably benign
IGL02051:Hspg2	APN	4	137568389	unclassified	probably benign
IGL02124:Hspg2	APN	4	137518814	splice site	probably null
IGL02128:Hspg2	APN	4	137564016	missense	probably damaging	1.00
IGL02177:Hspg2	APN	4	137515316	missense	probably damaging	1.00
IGL02230:Hspg2	APN	4	137518645	missense	probably damaging	1.00
IGL02266:Hspg2	APN	4	137510577	missense	probably damaging	1.00
IGL02313:Hspg2	APN	4	137508389	missense	probably benign	0.03
IGL02477:Hspg2	APN	4	137544512	splice site	probably benign
IGL02514:Hspg2	APN	4	137569576	missense	probably benign	0.09
IGL02613:Hspg2	APN	4	137544420	missense	probably damaging	1.00
IGL02625:Hspg2	APN	4	137512642	missense	probably damaging	1.00
IGL02646:Hspg2	APN	4	137551848	missense	possibly damaging	0.60
IGL02651:Hspg2	APN	4	137557445	splice site	probably benign
IGL02701:Hspg2	APN	4	137557174	missense	probably damaging	0.96
IGL02833:Hspg2	APN	4	137555130	missense	probably benign	0.00
IGL02985:Hspg2	APN	4	137507803	missense	probably damaging	1.00
IGL03040:Hspg2	APN	4	137561825	critical splice donor site	probably null
IGL03181:Hspg2	APN	4	137515937	missense	probably damaging	1.00
IGL03349:Hspg2	APN	4	137560522	splice site	probably benign
G1patch:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
PIT4305001:Hspg2	UTSW	4	137550373	missense	possibly damaging	0.55
R0006:Hspg2	UTSW	4	137519931	missense	probably damaging	1.00
R0036:Hspg2	UTSW	4	137542849	missense	probably damaging	1.00
R0109:Hspg2	UTSW	4	137562201	missense	probably benign	0.15
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0132:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0245:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0388:Hspg2	UTSW	4	137511158	missense	probably damaging	1.00
R0389:Hspg2	UTSW	4	137515423	missense	possibly damaging	0.53
R0468:Hspg2	UTSW	4	137533529	missense	probably damaging	1.00
R0480:Hspg2	UTSW	4	137550024	missense	probably damaging	1.00
R0546:Hspg2	UTSW	4	137502294	missense	probably benign
R0599:Hspg2	UTSW	4	137512401	missense	probably damaging	0.98
R0652:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0671:Hspg2	UTSW	4	137553280	missense	probably damaging	1.00
R0760:Hspg2	UTSW	4	137512349	missense	probably damaging	1.00
R0883:Hspg2	UTSW	4	137541440	missense	probably benign	0.00
R1403:Hspg2	UTSW	4	137540100	missense	possibly damaging	0.90
R1417:Hspg2	UTSW	4	137517636	missense	probably benign
R1497:Hspg2	UTSW	4	137548096	missense	probably damaging	0.98
R1509:Hspg2	UTSW	4	137511241	splice site	probably benign
R1625:Hspg2	UTSW	4	137518971	missense	probably benign	0.23
R1630:Hspg2	UTSW	4	137518435	missense	probably damaging	1.00
R1651:Hspg2	UTSW	4	137533437	nonsense	probably null
R1699:Hspg2	UTSW	4	137548012	splice site	probably null
R1703:Hspg2	UTSW	4	137559151	missense	probably damaging	1.00
R1761:Hspg2	UTSW	4	137514673	missense	possibly damaging	0.90
R1775:Hspg2	UTSW	4	137520156	missense	probably damaging	0.99
R1779:Hspg2	UTSW	4	137518509	missense	probably damaging	1.00
R1843:Hspg2	UTSW	4	137545567	missense	probably damaging	1.00
R1891:Hspg2	UTSW	4	137565490	missense	probably damaging	1.00
R1930:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1931:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1942:Hspg2	UTSW	4	137542552	missense	possibly damaging	0.67
R1959:Hspg2	UTSW	4	137564895	missense	probably damaging	1.00
R2042:Hspg2	UTSW	4	137568366	missense	probably damaging	1.00
R2062:Hspg2	UTSW	4	137559367	missense	possibly damaging	0.79
R2098:Hspg2	UTSW	4	137520109	missense	probably damaging	1.00
R2158:Hspg2	UTSW	4	137517604	missense	probably damaging	1.00
R2280:Hspg2	UTSW	4	137522043	missense	probably damaging	1.00
R2890:Hspg2	UTSW	4	137549574	missense	probably damaging	1.00
R2927:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R3428:Hspg2	UTSW	4	137555290	missense	probably damaging	1.00
R3744:Hspg2	UTSW	4	137565504	splice site	probably benign
R3873:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3874:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3917:Hspg2	UTSW	4	137559314	missense	probably damaging	1.00
R3932:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R3933:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R4134:Hspg2	UTSW	4	137556657	missense	probably damaging	0.99
R4272:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4273:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4274:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4275:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4288:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4289:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4354:Hspg2	UTSW	4	137468911	missense	probably benign	0.17
R4355:Hspg2	UTSW	4	137529418	missense	probably damaging	0.98
R4400:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4411:Hspg2	UTSW	4	137562224	missense	probably benign
R4421:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4592:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137539575	missense	possibly damaging	0.80
R4619:Hspg2	UTSW	4	137546573	missense	probably damaging	1.00
R4658:Hspg2	UTSW	4	137533730	missense	probably damaging	1.00
R4667:Hspg2	UTSW	4	137539645	missense	possibly damaging	0.90
R4724:Hspg2	UTSW	4	137522127	missense	probably damaging	0.96
R4739:Hspg2	UTSW	4	137570073	unclassified	probably benign
R4793:Hspg2	UTSW	4	137529473	missense	possibly damaging	0.95
R4826:Hspg2	UTSW	4	137565395	missense	probably damaging	1.00
R4838:Hspg2	UTSW	4	137541666	missense	possibly damaging	0.53
R4896:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4926:Hspg2	UTSW	4	137542530	missense	probably damaging	1.00
R4939:Hspg2	UTSW	4	137508031	missense	probably damaging	1.00
R5032:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5033:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5071:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5072:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5114:Hspg2	UTSW	4	137511926	missense	probably damaging	1.00
R5177:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R5223:Hspg2	UTSW	4	137543914	missense	probably damaging	1.00
R5433:Hspg2	UTSW	4	137528794	splice site	probably null
R5529:Hspg2	UTSW	4	137551828	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137520551	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137542825	missense	probably benign	0.17
R5546:Hspg2	UTSW	4	137548174	critical splice donor site	probably null
R5728:Hspg2	UTSW	4	137542766	missense	possibly damaging	0.95
R5764:Hspg2	UTSW	4	137561721	missense	probably damaging	1.00
R5920:Hspg2	UTSW	4	137553782	missense	probably damaging	1.00
R5934:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R6074:Hspg2	UTSW	4	137540735	missense	probably benign
R6175:Hspg2	UTSW	4	137569518	missense	probably damaging	1.00
R6217:Hspg2	UTSW	4	137540248	missense	probably damaging	0.99
R6262:Hspg2	UTSW	4	137519686	missense	probably damaging	1.00
R6299:Hspg2	UTSW	4	137544705	missense	probably damaging	1.00
R6333:Hspg2	UTSW	4	137561955	missense	probably damaging	1.00
R6371:Hspg2	UTSW	4	137541695	missense	probably damaging	1.00
R6430:Hspg2	UTSW	4	137539396	missense	probably damaging	1.00
R6498:Hspg2	UTSW	4	137507801	missense	possibly damaging	0.46
R6522:Hspg2	UTSW	4	137555275	missense	probably damaging	1.00
R6680:Hspg2	UTSW	4	137565737	missense	probably benign	0.18
R6724:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6725:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6762:Hspg2	UTSW	4	137551803	missense	possibly damaging	0.83
R6785:Hspg2	UTSW	4	137508398	missense	probably damaging	0.99
R6788:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6931:Hspg2	UTSW	4	137540720	missense	probably damaging	1.00
R6959:Hspg2	UTSW	4	137519289	missense	probably benign	0.45
R6968:Hspg2	UTSW	4	137535156	missense	probably damaging	1.00
R6988:Hspg2	UTSW	4	137528890	missense	probably damaging	1.00
R7021:Hspg2	UTSW	4	137542269	missense	possibly damaging	0.69
R7089:Hspg2	UTSW	4	137544366	missense	possibly damaging	0.51
R7107:Hspg2	UTSW	4	137510652	missense	probably damaging	1.00
R7141:Hspg2	UTSW	4	137552116	missense	probably damaging	1.00
R7161:Hspg2	UTSW	4	137514719	missense	probably damaging	1.00
R7189:Hspg2	UTSW	4	137533561	critical splice donor site	probably null
R7238:Hspg2	UTSW	4	137508393	missense	probably damaging	1.00
R7253:Hspg2	UTSW	4	137519946	missense	probably benign	0.15
R7278:Hspg2	UTSW	4	137551125	missense	probably damaging	0.98
R7287:Hspg2	UTSW	4	137529556	missense	probably benign	0.00
R7390:Hspg2	UTSW	4	137539179	missense	probably damaging	1.00
R7436:Hspg2	UTSW	4	137515664	missense	probably damaging	0.99
R7479:Hspg2	UTSW	4	137539403	missense	probably benign	0.17
R7516:Hspg2	UTSW	4	137542620	missense	possibly damaging	0.94
R7540:Hspg2	UTSW	4	137541440	missense	possibly damaging	0.51
R7603:Hspg2	UTSW	4	137548368	missense	probably damaging	1.00
R7603:Hspg2	UTSW	4	137557192	missense	possibly damaging	0.91
R7625:Hspg2	UTSW	4	137564938	missense	probably damaging	1.00
R7696:Hspg2	UTSW	4	137511966	missense	possibly damaging	0.78
R7767:Hspg2	UTSW	4	137511866	missense	probably damaging	1.00
R7815:Hspg2	UTSW	4	137512464	missense	probably damaging	1.00
R7825:Hspg2	UTSW	4	137558849	missense	probably damaging	1.00
R7863:Hspg2	UTSW	4	137564824	missense	probably benign	0.03
R7885:Hspg2	UTSW	4	137516837	missense	probably damaging	1.00
R7899:Hspg2	UTSW	4	137548116	missense	possibly damaging	0.72
R7937:Hspg2	UTSW	4	137550932	missense	probably benign	0.01
R7975:Hspg2	UTSW	4	137555221	missense	probably benign	0.26
R8078:Hspg2	UTSW	4	137508022	missense	probably damaging	1.00
R8285:Hspg2	UTSW	4	137512663	missense	probably benign	0.18
R8314:Hspg2	UTSW	4	137539675	missense	probably benign	0.12
R8322:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8323:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8324:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8341:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8383:Hspg2	UTSW	4	137544370	missense	possibly damaging	0.66
R8425:Hspg2	UTSW	4	137550867	nonsense	probably null
R8491:Hspg2	UTSW	4	137553719	missense	probably benign	0.00
R8525:Hspg2	UTSW	4	137539448	missense	probably damaging	0.98
R8978:Hspg2	UTSW	4	137564030	missense	probably benign	0.09
R9152:Hspg2	UTSW	4	137522565	missense	possibly damaging	0.89
R9166:Hspg2	UTSW	4	137542874	missense	probably damaging	1.00
R9175:Hspg2	UTSW	4	137529346	missense	probably damaging	0.98
R9210:Hspg2	UTSW	4	137562479	missense	probably benign	0.05
R9221:Hspg2	UTSW	4	137560415	missense	possibly damaging	0.79
R9325:Hspg2	UTSW	4	137538241	missense	probably damaging	1.00
R9339:Hspg2	UTSW	4	137551169	missense	probably benign
R9340:Hspg2	UTSW	4	137569516	missense	probably damaging	1.00
R9358:Hspg2	UTSW	4	137517598	missense	probably damaging	1.00
R9451:Hspg2	UTSW	4	137511069	missense	probably damaging	1.00
R9534:Hspg2	UTSW	4	137540761	missense	probably benign
R9656:Hspg2	UTSW	4	137551885	missense	probably benign
R9664:Hspg2	UTSW	4	137539576	missense	probably benign	0.03
R9695:Hspg2	UTSW	4	137538390	missense	probably damaging	1.00
R9741:Hspg2	UTSW	4	137512651	missense	probably damaging	1.00
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
X0028:Hspg2	UTSW	4	137550391	missense	probably benign
Z1177:Hspg2	UTSW	4	137550467	missense	probably damaging	1.00
Z1177:Hspg2	UTSW	4	137564518	missense	probably damaging	0.99
Z1177:Hspg2	UTSW	4	137568373	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- GCTTGGCTACAACCTGATGTC -3'
(R):5'- AGAGCAGAGATCTTGCCTCTTCC -3'

Sequencing Primer
(F):5'- CAGGAGGGAGGCATCTGTTTTCTC -3'
(R):5'- TTCCCTAGAGAAGAAGCTGCCATG -3'

Posted On

2017-10-10