Incidental Mutation 'R6164:Sh3tc1'
ID490033
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene NameSH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location35697180-35739987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35706246 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 866 (V866L)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
Predicted Effect probably benign
Transcript: ENSMUST00000070203
AA Change: V866L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: V866L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: V804L
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: V804L

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably benign
Transcript: ENSMUST00000201511
AA Change: V866L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: V866L

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35710957 missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35703375 missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35700316 missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35718995 missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35703352 missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35706284 missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35707172 missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35714059 splice site probably null
R0280:Sh3tc1 UTSW 5 35706017 missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35723999 missense probably benign
R0322:Sh3tc1 UTSW 5 35706561 missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35702012 splice site probably benign
R0511:Sh3tc1 UTSW 5 35703462 missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35700307 missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35724066 small deletion probably benign
R0550:Sh3tc1 UTSW 5 35699784 missense probably damaging 0.99
R0676:Sh3tc1 UTSW 5 35719114 splice site probably benign
R1485:Sh3tc1 UTSW 5 35719026 missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35703349 critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35707512 missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35705904 missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35705924 missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35700584 critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35716164 missense probably benign 0.01
R2092:Sh3tc1 UTSW 5 35700658 missense probably damaging 1.00
R2944:Sh3tc1 UTSW 5 35714160 missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35706978 missense probably benign 0.00
R4556:Sh3tc1 UTSW 5 35707082 missense probably damaging 1.00
R4647:Sh3tc1 UTSW 5 35706318 missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35700289 missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35707055 missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35706951 nonsense probably null
R6262:Sh3tc1 UTSW 5 35699773 missense probably damaging 1.00
R6433:Sh3tc1 UTSW 5 35706597 missense probably damaging 0.99
R6932:Sh3tc1 UTSW 5 35707434 missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35723944 missense probably benign
R7098:Sh3tc1 UTSW 5 35702014 splice site probably null
R7502:Sh3tc1 UTSW 5 35706062 missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35723953 missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35710951 missense probably damaging 0.97
R8079:Sh3tc1 UTSW 5 35706857 missense possibly damaging 0.78
R8154:Sh3tc1 UTSW 5 35718352 missense probably damaging 1.00
R8267:Sh3tc1 UTSW 5 35706407 missense probably benign 0.01
R8300:Sh3tc1 UTSW 5 35697448 missense probably benign 0.00
R8416:Sh3tc1 UTSW 5 35710912 missense probably damaging 0.99
R8459:Sh3tc1 UTSW 5 35721589 missense probably benign
X0061:Sh3tc1 UTSW 5 35706809 missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35714229 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACACAGGGCCCCAAAGTTAG -3'
(R):5'- CCAGATTGCTTACTACCTCAGACAG -3'

Sequencing Primer
(F):5'- AGTTAGCCAGGACCACTGC -3'
(R):5'- AGCCTGGCTCAACTGTACAGTC -3'
Posted On2017-10-10