Incidental Mutation 'R6164:Sdk1'
ID490035
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142132069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1574 (T1574M)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably damaging
Transcript: ENSMUST00000074546
AA Change: T1314M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T1314M

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085774
AA Change: T1574M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T1574M

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Meta Mutation Damage Score 0.2360 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 splice site probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
R7985:Sdk1 UTSW 5 142127847 missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142191893 missense probably benign 0.10
R8217:Sdk1 UTSW 5 142211958 missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142188015 critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142158621 missense possibly damaging 0.83
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense probably null 0.58
Z1177:Sdk1 UTSW 5 141962708 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCCAGCATGGTTAAAGGAGC -3'
(R):5'- ATTTCTTCAGTGCTGGGCC -3'

Sequencing Primer
(F):5'- GAGCCATCCTTGTTACATTAGGCAG -3'
(R):5'- GGCCAGTCCTCTCCTGTAGAC -3'
Posted On2017-10-10