Incidental Mutation 'R6164:Nlrp4c'
ID 490043
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene Name NLR family, pyrin domain containing 4C
Synonyms Nalp4c, Nalp-alpha, Rnh2
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 6048160-6108148 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6095507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 795 (L795P)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
AlphaFold Q3TKR3
Predicted Effect probably damaging
Transcript: ENSMUST00000037728
AA Change: L795P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: L795P

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121583
AA Change: L795P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: L795P

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208360
AA Change: L795P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anpep A G 7: 79,491,953 (GRCm39) I16T possibly damaging Het
Ap1s1 T C 5: 137,066,240 (GRCm39) probably benign Het
Atp1a2 T C 1: 172,106,459 (GRCm39) S848G probably damaging Het
Bche T A 3: 73,608,389 (GRCm39) I346F possibly damaging Het
Ccdc148 T A 2: 58,713,645 (GRCm39) Y502F probably damaging Het
Ccdc88c T C 12: 100,919,642 (GRCm39) M416V probably damaging Het
Cdk17 T C 10: 93,071,331 (GRCm39) S351P probably benign Het
Cfap100 T C 6: 90,392,768 (GRCm39) E114G probably benign Het
Clec4a4 T C 6: 122,968,833 (GRCm39) I66T possibly damaging Het
Cpeb4 T C 11: 31,870,584 (GRCm39) probably null Het
Cybrd1 T C 2: 70,948,618 (GRCm39) V52A probably damaging Het
Decr1 G A 4: 15,924,347 (GRCm39) A191V probably benign Het
Dnah5 A T 15: 28,378,489 (GRCm39) I2942L probably benign Het
Ehd4 C T 2: 119,932,689 (GRCm39) V246I possibly damaging Het
Ercc6l2 A G 13: 64,020,158 (GRCm39) probably benign Het
Exoc4 T A 6: 33,309,218 (GRCm39) M280K probably damaging Het
Fmo1 T G 1: 162,678,979 (GRCm39) E89A probably benign Het
Foxm1 A G 6: 128,350,898 (GRCm39) D733G probably benign Het
Garin5b T C 7: 4,773,677 (GRCm39) T73A probably damaging Het
Gulp1 A C 1: 44,793,511 (GRCm39) R57S probably damaging Het
Hdac1-ps T C 17: 78,799,716 (GRCm39) S236P probably damaging Het
Hdac4 G T 1: 91,957,876 (GRCm39) A46E probably benign Het
Hspg2 T C 4: 137,241,966 (GRCm39) S567P possibly damaging Het
Insyn1 C A 9: 58,406,530 (GRCm39) P147T probably damaging Het
Iqgap1 A C 7: 80,458,854 (GRCm39) C21W unknown Het
Isoc2a T C 7: 4,894,488 (GRCm39) L57P probably damaging Het
Krt34 G A 11: 99,929,272 (GRCm39) Q313* probably null Het
Krt6a C T 15: 101,601,008 (GRCm39) V263I probably damaging Het
Man2a1 A G 17: 65,040,719 (GRCm39) I106V possibly damaging Het
Muc16 T C 9: 18,469,675 (GRCm39) D7300G probably damaging Het
Muc5b A T 7: 141,417,082 (GRCm39) S3343C possibly damaging Het
Mup11 C T 4: 60,618,239 (GRCm39) E21K possibly damaging Het
Myo3b T A 2: 70,075,754 (GRCm39) probably null Het
Nup160 T A 2: 90,548,220 (GRCm39) Y984* probably null Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or2d3 G T 7: 106,491,135 (GRCm39) Y60* probably null Het
Or5p52 A G 7: 107,502,595 (GRCm39) T224A probably benign Het
Osmr A G 15: 6,889,833 (GRCm39) V5A probably benign Het
Pabir1 T A 19: 24,454,450 (GRCm39) M91L probably benign Het
Pcsk5 A G 19: 17,814,317 (GRCm39) probably null Het
Pex11a G A 7: 79,387,127 (GRCm39) T235M probably damaging Het
Pik3r6 A G 11: 68,442,799 (GRCm39) T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 (GRCm39) probably benign Het
Ppp2r2d T C 7: 138,474,742 (GRCm39) I41T probably damaging Het
Prdm1 C T 10: 44,326,191 (GRCm39) R126H probably damaging Het
Primpol C T 8: 47,039,477 (GRCm39) R381H probably benign Het
Prl7a1 C A 13: 27,821,626 (GRCm39) Q102H probably benign Het
Rbpjl T C 2: 164,252,799 (GRCm39) L284P probably damaging Het
Rgs21 A T 1: 144,417,035 (GRCm39) C6S probably benign Het
Rnasel T C 1: 153,630,138 (GRCm39) V218A probably benign Het
Sag G T 1: 87,752,175 (GRCm39) V223L probably damaging Het
Sdk1 C T 5: 142,117,824 (GRCm39) T1574M probably damaging Het
Secisbp2 G A 13: 51,833,896 (GRCm39) V679M probably damaging Het
Sele T A 1: 163,879,386 (GRCm39) probably null Het
Senp7 T A 16: 55,990,117 (GRCm39) L622M probably damaging Het
Sgo1 G A 17: 53,983,981 (GRCm39) R466C probably damaging Het
Sh3tc1 C A 5: 35,863,590 (GRCm39) V866L probably benign Het
Snrnp25 T A 11: 32,157,647 (GRCm39) V75D probably benign Het
Syne1 C T 10: 5,011,429 (GRCm39) C7899Y probably damaging Het
U2af1l4 T C 7: 30,264,007 (GRCm39) S55P probably damaging Het
Vmn1r23 A G 6: 57,903,040 (GRCm39) I246T possibly damaging Het
Vmn1r66 T A 7: 10,008,329 (GRCm39) R235* probably null Het
Wnk4 C T 11: 101,165,894 (GRCm39) A807V possibly damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6,069,701 (GRCm39) missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6,063,655 (GRCm39) missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6,069,111 (GRCm39) nonsense probably null
IGL02087:Nlrp4c APN 7 6,095,582 (GRCm39) missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6,069,828 (GRCm39) missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6,087,647 (GRCm39) missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6,068,726 (GRCm39) missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6,101,951 (GRCm39) missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6,068,974 (GRCm39) missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6,087,679 (GRCm39) missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6,069,415 (GRCm39) missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6,063,844 (GRCm39) missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6,068,942 (GRCm39) missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6,069,777 (GRCm39) missense probably benign
R1636:Nlrp4c UTSW 7 6,069,737 (GRCm39) missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6,076,221 (GRCm39) missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6,069,955 (GRCm39) splice site probably null
R1827:Nlrp4c UTSW 7 6,068,765 (GRCm39) missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6,087,655 (GRCm39) missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6,068,818 (GRCm39) missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign
R2415:Nlrp4c UTSW 7 6,069,047 (GRCm39) missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6,068,627 (GRCm39) missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6,103,826 (GRCm39) nonsense probably null
R4709:Nlrp4c UTSW 7 6,068,424 (GRCm39) missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6,069,125 (GRCm39) missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6,069,824 (GRCm39) missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6,069,622 (GRCm39) missense probably benign 0.06
R6383:Nlrp4c UTSW 7 6,069,052 (GRCm39) missense probably benign
R6650:Nlrp4c UTSW 7 6,068,948 (GRCm39) missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6,069,754 (GRCm39) missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6,063,792 (GRCm39) missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7104:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7232:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7444:Nlrp4c UTSW 7 6,095,595 (GRCm39) nonsense probably null
R7705:Nlrp4c UTSW 7 6,075,635 (GRCm39) missense probably damaging 0.97
R7966:Nlrp4c UTSW 7 6,069,322 (GRCm39) missense probably damaging 0.99
R8506:Nlrp4c UTSW 7 6,103,775 (GRCm39) missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6,075,644 (GRCm39) missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6,068,603 (GRCm39) missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6,069,337 (GRCm39) missense
R9031:Nlrp4c UTSW 7 6,107,608 (GRCm39) makesense probably null
R9193:Nlrp4c UTSW 7 6,095,621 (GRCm39) missense probably benign
R9329:Nlrp4c UTSW 7 6,068,498 (GRCm39) missense probably benign
R9388:Nlrp4c UTSW 7 6,069,874 (GRCm39) nonsense probably null
R9474:Nlrp4c UTSW 7 6,068,626 (GRCm39) missense possibly damaging 0.83
R9567:Nlrp4c UTSW 7 6,063,624 (GRCm39) missense probably benign 0.17
R9702:Nlrp4c UTSW 7 6,068,801 (GRCm39) missense probably benign 0.00
X0060:Nlrp4c UTSW 7 6,068,917 (GRCm39) missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6,069,635 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTAGATCTAGTGTGAAGTCAG -3'
(R):5'- CCTACCTGGCATACACTCAG -3'

Sequencing Primer
(F):5'- TCTAGTGTGAAGTCAGATGAAGG -3'
(R):5'- TGGCATACACTCAGGCATATAC -3'
Posted On 2017-10-10