Incidental Mutation 'R6164:U2af1l4'
ID490045
Institutional Source Beutler Lab
Gene Symbol U2af1l4
Ensembl Gene ENSMUSG00000078765
Gene NameU2 small nuclear RNA auxiliary factor 1-like 4
Synonymsauxiliary factor 26, U2af26
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30563301-30565365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30564582 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 55 (S55P)
Ref Sequence ENSEMBL: ENSMUSP00000146834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000043273] [ENSMUST00000043850] [ENSMUST00000043898] [ENSMUST00000043975] [ENSMUST00000108154] [ENSMUST00000108161] [ENSMUST00000108164] [ENSMUST00000156241] [ENSMUST00000163276] [ENSMUST00000163464] [ENSMUST00000163654] [ENSMUST00000166257] [ENSMUST00000166510] [ENSMUST00000166960] [ENSMUST00000167042] [ENSMUST00000167361] [ENSMUST00000163330] [ENSMUST00000167202] [ENSMUST00000167501] [ENSMUST00000168229] [ENSMUST00000163482] [ENSMUST00000164365] [ENSMUST00000163848] [ENSMUST00000171850] [ENSMUST00000171912] [ENSMUST00000208628] [ENSMUST00000207747] [ENSMUST00000207797] [ENSMUST00000207031] [ENSMUST00000168333] [ENSMUST00000168555] [ENSMUST00000168931] [ENSMUST00000172251]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043273
AA Change: S153P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039406
Gene: ENSMUSG00000078765
AA Change: S153P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043850
SMART Domains Protein: ENSMUSP00000042312
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043898
SMART Domains Protein: ENSMUSP00000044682
Gene: ENSMUSG00000036835

DomainStartEndE-ValueType
Pfam:PEN-2 7 99 2.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043975
SMART Domains Protein: ENSMUSP00000048557
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 84 240 5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108161
SMART Domains Protein: ENSMUSP00000103796
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 8.8e-10 PFAM
SCOP:d1jmta_ 43 115 2e-17 SMART
PDB:1JMT|A 43 116 3e-40 PDB
Blast:RRM 45 116 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108164
SMART Domains Protein: ENSMUSP00000103799
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 58 229 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149400
Predicted Effect probably benign
Transcript: ENSMUST00000156241
SMART Domains Protein: ENSMUSP00000122248
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 80 202 7.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163276
Predicted Effect possibly damaging
Transcript: ENSMUST00000163464
AA Change: S153P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125959
Gene: ENSMUSG00000078765
AA Change: S153P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 171 3.95e1 SMART
low complexity region 183 215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163654
AA Change: S153P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131048
Gene: ENSMUSG00000078765
AA Change: S153P

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 1.3e-9 PFAM
RRM 66 143 5.99e-4 SMART
low complexity region 167 187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166257
AA Change: S114P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125838
Gene: ENSMUSG00000078765
AA Change: S114P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 33 104 2.35e-2 SMART
ZnF_C3H1 110 136 2.49e-1 SMART
low complexity region 148 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166510
AA Change: S143P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132316
Gene: ENSMUSG00000078765
AA Change: S143P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 45 133 2.51e-6 SMART
ZnF_C3H1 139 165 2.49e-1 SMART
low complexity region 177 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166960
AA Change: S55P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000167042
AA Change: S153P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128886
Gene: ENSMUSG00000109378
AA Change: S153P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167361
AA Change: S55P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000163330
AA Change: S55P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129385
Gene: ENSMUSG00000078765
AA Change: S55P

DomainStartEndE-ValueType
RRM 39 116 5.99e-4 SMART
Pfam:zf-CCCH 122 148 4.9e-8 PFAM
low complexity region 160 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165543
Predicted Effect probably benign
Transcript: ENSMUST00000167202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164438
Predicted Effect probably benign
Transcript: ENSMUST00000167501
Predicted Effect probably benign
Transcript: ENSMUST00000168229
Predicted Effect probably benign
Transcript: ENSMUST00000163482
SMART Domains Protein: ENSMUSP00000130649
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164365
Predicted Effect probably benign
Transcript: ENSMUST00000165722
SMART Domains Protein: ENSMUSP00000125790
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 1 26 4.7e-10 PFAM
PDB:1JMT|A 30 51 2e-6 PDB
SCOP:d1jmta_ 30 51 5e-3 SMART
Blast:RRM 32 53 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163848
Predicted Effect probably damaging
Transcript: ENSMUST00000171850
AA Change: S120P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131781
Gene: ENSMUSG00000078765
AA Change: S120P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
PDB:1JMT|A 43 113 1e-16 PDB
SCOP:d1jmta_ 43 113 1e-9 SMART
Blast:RRM 45 110 3e-17 BLAST
ZnF_C3H1 116 142 2.49e-1 SMART
low complexity region 154 186 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171912
AA Change: S153P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130983
Gene: ENSMUSG00000109378
AA Change: S153P

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169962
Predicted Effect probably benign
Transcript: ENSMUST00000207747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171364
Predicted Effect probably benign
Transcript: ENSMUST00000207797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207972
Predicted Effect probably benign
Transcript: ENSMUST00000207031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170453
Predicted Effect probably benign
Transcript: ENSMUST00000168333
SMART Domains Protein: ENSMUSP00000128950
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 4.8e-10 PFAM
PDB:1JMT|A 43 94 5e-21 PDB
SCOP:d1jmta_ 43 94 2e-9 SMART
Blast:RRM 45 94 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168555
Predicted Effect probably benign
Transcript: ENSMUST00000168931
SMART Domains Protein: ENSMUSP00000129697
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 44 119 4.14e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172251
SMART Domains Protein: ENSMUSP00000132400
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 267 284 N/A INTRINSIC
Meta Mutation Damage Score 0.3940 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display abnormal circadian rhythms in response to changing external cues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in U2af1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4738:U2af1l4 UTSW 7 30563348 intron probably benign
R5262:U2af1l4 UTSW 7 30564213 missense probably benign 0.05
R7164:U2af1l4 UTSW 7 30565119 missense probably benign 0.08
R7429:U2af1l4 UTSW 7 30563390 missense probably benign 0.25
R7569:U2af1l4 UTSW 7 30563557 missense probably damaging 0.99
Z1176:U2af1l4 UTSW 7 30564281 missense probably benign 0.00
Z1177:U2af1l4 UTSW 7 30565140 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTCAGAGCTGACTAGTC -3'
(R):5'- TGGGTCTGAGGTACCTATGC -3'

Sequencing Primer
(F):5'- GAGCTGACTAGTCCCCTGAAGATC -3'
(R):5'- CAAGTTCCGAGATATGGGCC -3'
Posted On2017-10-10