Incidental Mutation 'R6164:Olfr472'
ID490050
Institutional Source Beutler Lab
Gene Symbol Olfr472
Ensembl Gene ENSMUSG00000073893
Gene Nameolfactory receptor 472
SynonymsMOR204-5, GA_x6K02T2PBJ9-10231953-10232885
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107897902-107907762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107903388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000150404 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000209670
AA Change: T224A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000210420
AA Change: T224A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210856
Predicted Effect probably benign
Transcript: ENSMUST00000216937
AA Change: T224A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Olfr472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Olfr472 APN 7 107903104 missense probably damaging 1.00
IGL02002:Olfr472 APN 7 107903290 missense possibly damaging 0.81
IGL02320:Olfr472 APN 7 107902831 missense possibly damaging 0.78
IGL02701:Olfr472 APN 7 107903442 missense probably benign 0.42
IGL03022:Olfr472 APN 7 107902981 missense probably benign 0.18
IGL03214:Olfr472 APN 7 107902966 missense probably benign 0.00
IGL03257:Olfr472 APN 7 107902756 missense probably benign 0.01
IGL03372:Olfr472 APN 7 107903370 missense probably damaging 1.00
R0081:Olfr472 UTSW 7 107903005 missense probably benign 0.00
R0669:Olfr472 UTSW 7 107903239 missense probably damaging 1.00
R0932:Olfr472 UTSW 7 107903190 missense possibly damaging 0.94
R1158:Olfr472 UTSW 7 107902923 missense possibly damaging 0.75
R1746:Olfr472 UTSW 7 107902886 missense probably benign 0.01
R3777:Olfr472 UTSW 7 107902747 missense probably benign
R3778:Olfr472 UTSW 7 107902747 missense probably benign
R4605:Olfr472 UTSW 7 107903238 missense probably benign 0.24
R4661:Olfr472 UTSW 7 107902981 missense probably benign 0.18
R4675:Olfr472 UTSW 7 107903360 missense probably damaging 1.00
R5374:Olfr472 UTSW 7 107903491 missense possibly damaging 0.52
R5686:Olfr472 UTSW 7 107902912 missense probably damaging 0.99
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6347:Olfr472 UTSW 7 107902950 missense possibly damaging 0.68
R6995:Olfr472 UTSW 7 107903622 missense probably benign 0.13
R7035:Olfr472 UTSW 7 107902933 missense probably benign
R7818:Olfr472 UTSW 7 107903023 missense probably benign 0.01
R7890:Olfr472 UTSW 7 107903043 missense probably benign 0.01
R8189:Olfr472 UTSW 7 107902732 missense probably damaging 0.99
R8301:Olfr472 UTSW 7 107903626 missense probably benign 0.24
Z1176:Olfr472 UTSW 7 107903058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTGTGGACCAACTCAG -3'
(R):5'- ACAATTGCTTTCCTCAGAGCATC -3'

Sequencing Primer
(F):5'- CTTCTGTGGACCAACTCAGATAAATC -3'
(R):5'- ACATAGGAATCACCACTGTGTAG -3'
Posted On2017-10-10