Incidental Mutation 'R6164:Ppp2r2d'
ID490051
Institutional Source Beutler Lab
Gene Symbol Ppp2r2d
Ensembl Gene ENSMUSG00000041769
Gene Nameprotein phosphatase 2, regulatory subunit B, delta
Synonyms1300017E19Rik, MDS026, D7Ertd753e
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location138846079-138883057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138873013 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 41 (I41T)
Ref Sequence ENSEMBL: ENSMUSP00000119004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041097] [ENSMUST00000136824] [ENSMUST00000148453] [ENSMUST00000155672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041097
AA Change: I206T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040321
Gene: ENSMUSG00000041769
AA Change: I206T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WD40 27 62 1.91e1 SMART
WD40 89 129 4.77e0 SMART
WD40 171 210 1.19e0 SMART
WD40 221 261 1.91e1 SMART
WD40 280 318 4.11e1 SMART
WD40 345 376 2.54e2 SMART
WD40 412 449 3.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128157
Predicted Effect probably benign
Transcript: ENSMUST00000136824
SMART Domains Protein: ENSMUSP00000133380
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
PDB:3DW8|E 6 69 3e-31 PDB
Blast:WD40 15 57 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140047
Predicted Effect probably benign
Transcript: ENSMUST00000148453
SMART Domains Protein: ENSMUSP00000119183
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:3DW8|E 14 33 9e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152104
Predicted Effect probably damaging
Transcript: ENSMUST00000155672
AA Change: I41T

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119004
Gene: ENSMUSG00000041769
AA Change: I41T

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
WD40 115 153 4.11e1 SMART
WD40 180 211 2.54e2 SMART
WD40 247 284 3.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172764
SMART Domains Protein: ENSMUSP00000133810
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
SCOP:d1k32a3 2 103 9e-8 SMART
PDB:3DW8|E 2 127 2e-75 PDB
Blast:WD40 56 96 4e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174090
SMART Domains Protein: ENSMUSP00000134581
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
Meta Mutation Damage Score 0.7046 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Ppp2r2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ppp2r2d APN 7 138882211 missense probably benign
IGL01538:Ppp2r2d APN 7 138876635 missense probably damaging 1.00
IGL02266:Ppp2r2d APN 7 138868437 missense probably damaging 0.97
IGL02268:Ppp2r2d APN 7 138872971 missense probably null 1.00
IGL03263:Ppp2r2d APN 7 138872922 nonsense probably null
R0482:Ppp2r2d UTSW 7 138870431 missense probably benign 0.08
R1946:Ppp2r2d UTSW 7 138868467 missense probably damaging 1.00
R4043:Ppp2r2d UTSW 7 138882416 nonsense probably null
R4326:Ppp2r2d UTSW 7 138868485 missense probably damaging 1.00
R7076:Ppp2r2d UTSW 7 138876597 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACCGGACGCTTATGCTATTATG -3'
(R):5'- CACATGAACTTTCAGGCAAAGG -3'

Sequencing Primer
(F):5'- GGACGCTTATGCTATTATGATCTTTG -3'
(R):5'- GCAAAGGTTTGTATCTTTAGGGACAC -3'
Posted On2017-10-10