Incidental Mutation 'R6164:Primpol'
ID490053
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Nameprimase and polymerase (DNA-directed)
SynonymsCcdc111
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location46575594-46617212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46586442 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 381 (R381H)
Ref Sequence ENSEMBL: ENSMUSP00000147574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040468] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably benign
Transcript: ENSMUST00000040468
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225
AA Change: R381H

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123328
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect probably benign
Transcript: ENSMUST00000209787
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000211400
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 46581597 missense probably damaging 0.98
IGL02421:Primpol APN 8 46607795 splice site probably benign
IGL02886:Primpol APN 8 46593584 nonsense probably null
IGL03244:Primpol APN 8 46586440 missense probably damaging 1.00
R0243:Primpol UTSW 8 46599814 missense probably damaging 1.00
R0329:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0330:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0571:Primpol UTSW 8 46581639 missense probably damaging 1.00
R1266:Primpol UTSW 8 46593699 missense probably damaging 1.00
R1334:Primpol UTSW 8 46586391 missense probably damaging 1.00
R1469:Primpol UTSW 8 46593637 missense probably benign
R1469:Primpol UTSW 8 46593637 missense probably benign
R1524:Primpol UTSW 8 46586467 intron probably benign
R1738:Primpol UTSW 8 46607838 missense probably damaging 0.98
R2144:Primpol UTSW 8 46586343 missense probably damaging 0.99
R3747:Primpol UTSW 8 46599813 missense probably benign 0.34
R3748:Primpol UTSW 8 46599813 missense probably benign 0.34
R3750:Primpol UTSW 8 46599813 missense probably benign 0.34
R4378:Primpol UTSW 8 46576183 utr 3 prime probably benign
R4855:Primpol UTSW 8 46586691 missense probably benign 0.00
R5209:Primpol UTSW 8 46590260 missense probably benign 0.00
R5497:Primpol UTSW 8 46592622 nonsense probably null
R5720:Primpol UTSW 8 46581642 missense probably damaging 1.00
R5963:Primpol UTSW 8 46593580 missense possibly damaging 0.93
R6497:Primpol UTSW 8 46586341 critical splice donor site probably null
R6549:Primpol UTSW 8 46605150 missense probably damaging 1.00
R7595:Primpol UTSW 8 46610615 missense probably benign 0.00
R7775:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7778:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7824:Primpol UTSW 8 46586424 missense probably damaging 1.00
R8055:Primpol UTSW 8 46579162 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGCTGGTATGTGCTAGAAGTG -3'
(R):5'- TAAAGGAGGTAAGGCTTGGCTTTC -3'

Sequencing Primer
(F):5'- CTGGTATGTGCTAGAAGTGATTTAAC -3'
(R):5'- AGGTAAGGCTTGGCTTTCTCTCC -3'
Posted On2017-10-10