Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Primpol'

490053

Institutional Source

Beutler Lab

Gene Symbol

Primpol

Ensembl Gene

ENSMUSG00000038225

Gene Name

primase and polymerase (DNA-directed)

Synonyms

Ccdc111

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46575594-46617212 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46586442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 381 (R381H)

Ref Sequence

ENSEMBL: ENSMUSP00000147574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040468] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]

AlphaFold

Q6P1E7

Predicted Effect

probably benign
Transcript: ENSMUST00000040468
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225
AA Change: R381H

Domain	Start	End	E-Value	Type
Pfam:Herpes_UL52	384	448	1.3e-19	PFAM
low complexity region	465	478	N/A	INTRINSIC
low complexity region	491	516	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123328

Predicted Effect

probably benign
Transcript: ENSMUST00000136335

Predicted Effect

probably benign
Transcript: ENSMUST00000209787
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000211400
AA Change: R381H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Primpol

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Primpol	APN	8	46581597	missense	probably damaging	0.98
IGL02421:Primpol	APN	8	46607795	splice site	probably benign
IGL02886:Primpol	APN	8	46593584	nonsense	probably null
IGL03244:Primpol	APN	8	46586440	missense	probably damaging	1.00
R0243:Primpol	UTSW	8	46599814	missense	probably damaging	1.00
R0329:Primpol	UTSW	8	46610461	missense	probably damaging	0.97
R0330:Primpol	UTSW	8	46610461	missense	probably damaging	0.97
R0571:Primpol	UTSW	8	46581639	missense	probably damaging	1.00
R1266:Primpol	UTSW	8	46593699	missense	probably damaging	1.00
R1334:Primpol	UTSW	8	46586391	missense	probably damaging	1.00
R1469:Primpol	UTSW	8	46593637	missense	probably benign
R1469:Primpol	UTSW	8	46593637	missense	probably benign
R1524:Primpol	UTSW	8	46586467	intron	probably benign
R1738:Primpol	UTSW	8	46607838	missense	probably damaging	0.98
R2144:Primpol	UTSW	8	46586343	missense	probably damaging	0.99
R3747:Primpol	UTSW	8	46599813	missense	probably benign	0.34
R3748:Primpol	UTSW	8	46599813	missense	probably benign	0.34
R3750:Primpol	UTSW	8	46599813	missense	probably benign	0.34
R4378:Primpol	UTSW	8	46576183	utr 3 prime	probably benign
R4855:Primpol	UTSW	8	46586691	missense	probably benign	0.00
R5209:Primpol	UTSW	8	46590260	missense	probably benign	0.00
R5497:Primpol	UTSW	8	46592622	nonsense	probably null
R5720:Primpol	UTSW	8	46581642	missense	probably damaging	1.00
R5963:Primpol	UTSW	8	46593580	missense	possibly damaging	0.93
R6497:Primpol	UTSW	8	46586341	critical splice donor site	probably null
R6549:Primpol	UTSW	8	46605150	missense	probably damaging	1.00
R7595:Primpol	UTSW	8	46610615	missense	probably benign	0.00
R7775:Primpol	UTSW	8	46586424	missense	probably damaging	1.00
R7778:Primpol	UTSW	8	46586424	missense	probably damaging	1.00
R7824:Primpol	UTSW	8	46586424	missense	probably damaging	1.00
R8055:Primpol	UTSW	8	46579162	missense	probably benign	0.34
R8840:Primpol	UTSW	8	46593696	missense	probably damaging	1.00
R8992:Primpol	UTSW	8	46581562	splice site	probably benign
R9356:Primpol	UTSW	8	46590283	missense	probably benign	0.00
R9388:Primpol	UTSW	8	46581570	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AAGCTGGTATGTGCTAGAAGTG -3'
(R):5'- TAAAGGAGGTAAGGCTTGGCTTTC -3'

Sequencing Primer
(F):5'- CTGGTATGTGCTAGAAGTGATTTAAC -3'
(R):5'- AGGTAAGGCTTGGCTTTCTCTCC -3'

Posted On

2017-10-10