Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Syne1'

490057

Institutional Source

Beutler Lab

Gene Symbol

Syne1

Ensembl Gene

ENSMUSG00000096054

Gene Name

spectrin repeat containing, nuclear envelope 1

Synonyms

A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5020917-5551482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5061429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 7899 (C7899Y)

Ref Sequence

ENSEMBL: ENSMUSP00000150262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095899] [ENSMUST00000215295]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000095899
AA Change: C72Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093587
Gene: ENSMUSG00000096054
AA Change: C72Y

Domain	Start	End	E-Value	Type
SPEC	43	150	6.95e-13	SMART
SPEC	157	259	1.55e-10	SMART
SPEC	266	366	3.4e-16	SMART
low complexity region	372	386	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
coiled coil region	483	505	N/A	INTRINSIC
SPEC	595	698	6.9e-17	SMART
SPEC	705	809	8.82e-1	SMART
low complexity region	811	826	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
KASH	892	949	5.15e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000215295
AA Change: C7899Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217064

Meta Mutation Damage Score

0.8992

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Syne1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Syne1	APN	10	5342167	synonymous	probably benign
IGL00725:Syne1	APN	10	5344922	missense	possibly damaging	0.48
IGL00799:Syne1	APN	10	5347878	missense	probably benign	0.00
IGL01087:Syne1	APN	10	5425708	missense	probably damaging	1.00
IGL01123:Syne1	APN	10	5344921	nonsense	probably null
IGL01147:Syne1	APN	10	5052691	nonsense	probably null
IGL01150:Syne1	APN	10	5443154	missense	probably damaging	1.00
IGL01154:Syne1	APN	10	5360848	missense	probably damaging	1.00
IGL01727:Syne1	APN	10	5047842	missense	probably damaging	0.99
IGL01761:Syne1	APN	10	5405456	missense	probably damaging	1.00
IGL01793:Syne1	APN	10	5352191	missense	possibly damaging	0.67
IGL01961:Syne1	APN	10	5043723	missense	possibly damaging	0.94
IGL01975:Syne1	APN	10	5068908	intron	probably benign
IGL02152:Syne1	APN	10	5424382	missense	probably damaging	1.00
IGL02423:Syne1	APN	10	5368295	missense	probably benign	0.00
IGL02457:Syne1	APN	10	5342167	missense	probably damaging	1.00
IGL02543:Syne1	APN	10	5043618	missense	probably damaging	0.97
IGL02836:Syne1	APN	10	5409875	splice site	probably benign
IGL03141:Syne1	APN	10	5424261	missense	probably damaging	1.00
FR4548:Syne1	UTSW	10	5032969	missense	probably benign	0.09
IGL02799:Syne1	UTSW	10	5359059	missense	probably damaging	1.00
PIT4305001:Syne1	UTSW	10	5333023	missense	probably damaging	1.00
PIT4687001:Syne1	UTSW	10	5358390	missense	possibly damaging	0.87
R0004:Syne1	UTSW	10	5443132	splice site	probably benign
R0110:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0165:Syne1	UTSW	10	5033096	missense	probably benign	0.28
R0194:Syne1	UTSW	10	5424311	missense	probably benign
R0311:Syne1	UTSW	10	5348943	missense	possibly damaging	0.92
R0328:Syne1	UTSW	10	5348945	missense	possibly damaging	0.62
R0379:Syne1	UTSW	10	5541989	missense	probably damaging	1.00
R0387:Syne1	UTSW	10	5351029	missense	probably benign
R0452:Syne1	UTSW	10	5405435	missense	probably damaging	0.98
R0456:Syne1	UTSW	10	5342252	missense	probably benign	0.04
R0457:Syne1	UTSW	10	5022041	missense	probably damaging	1.00
R0469:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0510:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0533:Syne1	UTSW	10	5358438	missense	probably benign	0.00
R0617:Syne1	UTSW	10	5350933	missense	probably damaging	1.00
R0690:Syne1	UTSW	10	5033138	splice site	probably benign
R0964:Syne1	UTSW	10	5043652	missense	possibly damaging	0.95
R1133:Syne1	UTSW	10	5349044	missense	possibly damaging	0.77
R1327:Syne1	UTSW	10	5048925	splice site	probably benign
R1339:Syne1	UTSW	10	5367571	missense	probably damaging	1.00
R1531:Syne1	UTSW	10	5347875	nonsense	probably null
R1558:Syne1	UTSW	10	5349280	nonsense	probably null
R1633:Syne1	UTSW	10	5349388	missense	probably damaging	1.00
R1642:Syne1	UTSW	10	5348694	missense	possibly damaging	0.94
R1658:Syne1	UTSW	10	5367616	missense	probably benign	0.03
R1753:Syne1	UTSW	10	5367621	missense	probably benign	0.28
R1759:Syne1	UTSW	10	5349369	missense	probably damaging	1.00
R1792:Syne1	UTSW	10	5040975	missense	probably damaging	1.00
R2076:Syne1	UTSW	10	5040897	missense	probably damaging	0.99
R2079:Syne1	UTSW	10	5361502	missense	probably benign	0.01
R2102:Syne1	UTSW	10	5056514	missense	probably damaging	1.00
R2233:Syne1	UTSW	10	5041484	missense	probably benign	0.01
R2305:Syne1	UTSW	10	5047573	missense	probably damaging	0.97
R3435:Syne1	UTSW	10	5348565	missense	probably damaging	1.00
R3749:Syne1	UTSW	10	5052267	splice site	probably benign
R3876:Syne1	UTSW	10	5052345	missense	possibly damaging	0.57
R3895:Syne1	UTSW	10	5405456	missense	probably damaging	0.98
R3974:Syne1	UTSW	10	5043630	missense	probably benign	0.06
R4042:Syne1	UTSW	10	5041584	missense	probably benign	0.21
R4120:Syne1	UTSW	10	5409798	missense	probably damaging	1.00
R4201:Syne1	UTSW	10	5347870	missense	probably benign
R4364:Syne1	UTSW	10	5353987	missense	probably damaging	0.96
R4498:Syne1	UTSW	10	5031768	missense	probably benign	0.00
R4767:Syne1	UTSW	10	5344866	nonsense	probably null
R4804:Syne1	UTSW	10	5349310	missense	possibly damaging	0.95
R4917:Syne1	UTSW	10	5057909	missense	probably damaging	1.00
R4930:Syne1	UTSW	10	5052777	missense	probably damaging	0.99
R5081:Syne1	UTSW	10	5047767	missense	probably benign	0.04
R5089:Syne1	UTSW	10	5405444	nonsense	probably null
R5174:Syne1	UTSW	10	5041490	missense	probably damaging	0.99
R5205:Syne1	UTSW	10	5052295	missense	probably benign	0.05
R5303:Syne1	UTSW	10	5420464	missense	probably benign	0.00
R5384:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5385:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5392:Syne1	UTSW	10	5348661	missense	probably damaging	1.00
R5442:Syne1	UTSW	10	5343473	missense	probably benign	0.09
R5750:Syne1	UTSW	10	5339209	missense	probably benign	0.01
R5935:Syne1	UTSW	10	5360706	splice site	probably null
R6015:Syne1	UTSW	10	5346819	critical splice donor site	probably null
R6023:Syne1	UTSW	10	5443223	missense	probably benign	0.09
R6049:Syne1	UTSW	10	5347926	missense	possibly damaging	0.79
R6084:Syne1	UTSW	10	5348994	missense	probably damaging	1.00
R6145:Syne1	UTSW	10	5052750	missense	probably damaging	1.00
R6165:Syne1	UTSW	10	5425678	missense	probably damaging	1.00
R6198:Syne1	UTSW	10	5302269	missense	probably damaging	0.99
R6217:Syne1	UTSW	10	5293761	missense	probably benign	0.00
R6247:Syne1	UTSW	10	5349071	missense	probably damaging	0.98
R6271:Syne1	UTSW	10	5234652	missense	probably damaging	1.00
R6338:Syne1	UTSW	10	5255475	missense	probably benign	0.00
R6344:Syne1	UTSW	10	5022212	missense	probably benign	0.08
R6434:Syne1	UTSW	10	5318422	missense	probably benign	0.01
R6476:Syne1	UTSW	10	5154531	missense	possibly damaging	0.88
R6479:Syne1	UTSW	10	5231679	nonsense	probably null
R6479:Syne1	UTSW	10	5456826	missense	probably damaging	1.00
R6546:Syne1	UTSW	10	5218645	nonsense	probably null
R6578:Syne1	UTSW	10	5405454	nonsense	probably null
R6611:Syne1	UTSW	10	5045273	missense	probably benign	0.01
R6615:Syne1	UTSW	10	5301340	missense	probably damaging	0.98
R6632:Syne1	UTSW	10	5215667	critical splice donor site	probably null
R6662:Syne1	UTSW	10	5128416	missense	probably damaging	1.00
R6677:Syne1	UTSW	10	5040942	missense	possibly damaging	0.82
R6764:Syne1	UTSW	10	5229011	nonsense	probably null
R6765:Syne1	UTSW	10	5143285	splice site	probably null
R6778:Syne1	UTSW	10	5102406	missense	probably damaging	0.97
R6851:Syne1	UTSW	10	5262703	nonsense	probably null
R6878:Syne1	UTSW	10	5420388	missense	possibly damaging	0.78
R6883:Syne1	UTSW	10	5231704	nonsense	probably null
R6910:Syne1	UTSW	10	5048887	missense	probably benign	0.01
R6916:Syne1	UTSW	10	5227912	missense	probably benign	0.00
R6925:Syne1	UTSW	10	5126682	missense	probably benign	0.00
R6943:Syne1	UTSW	10	5083940	missense	probably benign
R6947:Syne1	UTSW	10	5175789	missense	probably damaging	1.00
R6965:Syne1	UTSW	10	5229120	missense	possibly damaging	0.66
R6968:Syne1	UTSW	10	5117041	missense	probably benign	0.09
R7043:Syne1	UTSW	10	5072193	missense	possibly damaging	0.77
R7059:Syne1	UTSW	10	5346859	missense	probably damaging	1.00
R7067:Syne1	UTSW	10	5234586	missense	probably damaging	1.00
R7087:Syne1	UTSW	10	5542024	start gained	probably benign
R7099:Syne1	UTSW	10	5123744	missense	probably benign	0.43
R7107:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7120:Syne1	UTSW	10	5293971	missense	probably benign
R7127:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7128:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7131:Syne1	UTSW	10	5228221	missense	probably damaging	1.00
R7132:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7133:Syne1	UTSW	10	5231592	missense	probably damaging	1.00
R7135:Syne1	UTSW	10	5233409	missense	probably benign	0.01
R7147:Syne1	UTSW	10	5249340	missense	probably damaging	1.00
R7158:Syne1	UTSW	10	5057931	missense	probably damaging	1.00
R7189:Syne1	UTSW	10	5424295	missense	probably benign	0.03
R7193:Syne1	UTSW	10	5233406	missense	probably damaging	1.00
R7194:Syne1	UTSW	10	5110859	missense	probably damaging	1.00
R7233:Syne1	UTSW	10	5302160	missense	probably damaging	1.00
R7255:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7267:Syne1	UTSW	10	5228218	missense	probably damaging	1.00
R7294:Syne1	UTSW	10	5097483	critical splice donor site	probably null
R7303:Syne1	UTSW	10	5256805	missense	probably benign	0.04
R7313:Syne1	UTSW	10	5047635	missense	probably damaging	1.00
R7330:Syne1	UTSW	10	5128434	missense	probably benign	0.00
R7334:Syne1	UTSW	10	5057886	missense	probably damaging	1.00
R7363:Syne1	UTSW	10	5140970	missense	possibly damaging	0.45
R7400:Syne1	UTSW	10	5218580	missense	probably benign	0.12
R7425:Syne1	UTSW	10	5425760	missense	probably damaging	1.00
R7427:Syne1	UTSW	10	5273718	missense	probably damaging	0.98
R7446:Syne1	UTSW	10	5222266	missense	probably benign	0.00
R7462:Syne1	UTSW	10	5052793	missense	possibly damaging	0.87
R7502:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7525:Syne1	UTSW	10	5185559	critical splice acceptor site	probably null
R7529:Syne1	UTSW	10	5424382	missense	probably damaging	1.00
R7577:Syne1	UTSW	10	5124820	missense	probably damaging	1.00
R7579:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R7594:Syne1	UTSW	10	5215190	critical splice donor site	probably null
R7646:Syne1	UTSW	10	5172949	missense	probably damaging	1.00
R7651:Syne1	UTSW	10	5205074	missense	probably benign	0.38
R7651:Syne1	UTSW	10	5343416	missense	probably damaging	1.00
R7669:Syne1	UTSW	10	5061531	missense	probably damaging	1.00
R7672:Syne1	UTSW	10	5218527	missense	probably benign	0.02
R7682:Syne1	UTSW	10	5162461	missense	probably benign
R7702:Syne1	UTSW	10	5245835	missense	probably damaging	1.00
R7767:Syne1	UTSW	10	5333560	missense	possibly damaging	0.60
R7767:Syne1	UTSW	10	5333632	missense	possibly damaging	0.49
R7829:Syne1	UTSW	10	5342293	missense	probably damaging	0.96
R7840:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7859:Syne1	UTSW	10	5157683	missense	possibly damaging	0.80
R7899:Syne1	UTSW	10	5227956	nonsense	probably null
R7918:Syne1	UTSW	10	5359078	missense	possibly damaging	0.50
R7923:Syne1	UTSW	10	5264738	missense	probably damaging	1.00
R7946:Syne1	UTSW	10	5250919	missense	possibly damaging	0.92
R7966:Syne1	UTSW	10	5116965	critical splice donor site	probably null
R7975:Syne1	UTSW	10	5031786	missense	probably benign	0.00
R7981:Syne1	UTSW	10	5229248	missense	probably benign	0.04
R8053:Syne1	UTSW	10	5052658	nonsense	probably null
R8054:Syne1	UTSW	10	5270970	missense	probably benign	0.22
R8062:Syne1	UTSW	10	5185394	critical splice donor site	probably null
R8085:Syne1	UTSW	10	5228021	missense	possibly damaging	0.78
R8087:Syne1	UTSW	10	5333034	missense	probably benign
R8094:Syne1	UTSW	10	5117031	missense	probably damaging	0.98
R8310:Syne1	UTSW	10	5347829	missense	probably benign
R8325:Syne1	UTSW	10	5146257	missense	probably benign	0.15
R8342:Syne1	UTSW	10	5108622	missense	probably benign	0.18
R8353:Syne1	UTSW	10	5350983	missense	probably damaging	1.00
R8376:Syne1	UTSW	10	5043615	missense	probably benign	0.09
R8398:Syne1	UTSW	10	5124923	missense	probably damaging	1.00
R8434:Syne1	UTSW	10	5123057	missense	probably benign	0.00
R8436:Syne1	UTSW	10	5228659	missense	probably benign	0.26
R8459:Syne1	UTSW	10	5424277	nonsense	probably null
R8461:Syne1	UTSW	10	5061463	missense	probably benign	0.34
R8496:Syne1	UTSW	10	5228896	missense	probably damaging	0.99
R8496:Syne1	UTSW	10	5318441	missense	probably damaging	0.99
R8693:Syne1	UTSW	10	5140928	missense	possibly damaging	0.60
R8698:Syne1	UTSW	10	5229229	missense	probably damaging	1.00
R8701:Syne1	UTSW	10	5205026	nonsense	probably null
R8713:Syne1	UTSW	10	5316040	missense	probably damaging	1.00
R8724:Syne1	UTSW	10	5083861	missense	possibly damaging	0.77
R8729:Syne1	UTSW	10	5229275	missense	probably benign	0.00
R8742:Syne1	UTSW	10	5108661	missense	probably benign	0.09
R8757:Syne1	UTSW	10	5194618	missense	probably damaging	1.00
R8776:Syne1	UTSW	10	5231783	missense	possibly damaging	0.81
R8776-TAIL:Syne1	UTSW	10	5231783	missense	possibly damaging	0.81
R8778:Syne1	UTSW	10	5359066	missense	probably benign	0.00
R8801:Syne1	UTSW	10	5358335	missense	probably damaging	1.00
R8803:Syne1	UTSW	10	5361535	missense	probably damaging	1.00
R8808:Syne1	UTSW	10	5359074	missense	probably damaging	1.00
R8829:Syne1	UTSW	10	5108685	missense	probably benign
R8843:Syne1	UTSW	10	5193040	missense	possibly damaging	0.88
R8843:Syne1	UTSW	10	5330204	missense	probably benign	0.01
R8854:Syne1	UTSW	10	5128503	missense	probably benign	0.00
R8863:Syne1	UTSW	10	5099527	missense	probably damaging	1.00
R8864:Syne1	UTSW	10	5420473	missense	probably benign	0.01
R8881:Syne1	UTSW	10	5273639	missense	probably damaging	1.00
R8884:Syne1	UTSW	10	5231822	missense	possibly damaging	0.93
R8893:Syne1	UTSW	10	5349020	nonsense	probably null
R8958:Syne1	UTSW	10	5231768	missense	probably benign
R8964:Syne1	UTSW	10	5110872	missense
R8975:Syne1	UTSW	10	5211945	missense	probably benign	0.04
R8987:Syne1	UTSW	10	5227579	missense	possibly damaging	0.92
R8992:Syne1	UTSW	10	5185508	missense	probably benign	0.01
R9005:Syne1	UTSW	10	5205406	missense	probably benign
R9084:Syne1	UTSW	10	5339240	missense	probably benign	0.01
R9117:Syne1	UTSW	10	5103667	missense	probably damaging	0.96
R9128:Syne1	UTSW	10	5108556	missense	probably benign	0.38
R9181:Syne1	UTSW	10	5113994	missense	probably damaging	0.99
R9189:Syne1	UTSW	10	5173008	missense	probably damaging	1.00
R9189:Syne1	UTSW	10	5222289	missense	probably benign	0.00
R9205:Syne1	UTSW	10	5202013	nonsense	probably null
R9217:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R9246:Syne1	UTSW	10	5305706	missense	probably benign	0.00
R9264:Syne1	UTSW	10	5262793	missense	probably damaging	1.00
R9273:Syne1	UTSW	10	5040901	missense	probably benign	0.16
R9315:Syne1	UTSW	10	5333553	missense	possibly damaging	0.79
R9331:Syne1	UTSW	10	5123666	missense	probably benign	0.45
R9355:Syne1	UTSW	10	5368255	missense	probably damaging	1.00
R9378:Syne1	UTSW	10	5250954	missense	probably damaging	0.96
R9389:Syne1	UTSW	10	5229193	missense	possibly damaging	0.65
R9395:Syne1	UTSW	10	5311728	missense	probably damaging	1.00
R9405:Syne1	UTSW	10	5202030	missense	probably damaging	1.00
R9417:Syne1	UTSW	10	5132021	missense	probably benign
R9419:Syne1	UTSW	10	5205071	missense	probably benign	0.01
R9473:Syne1	UTSW	10	5248258	missense	probably benign	0.00
R9484:Syne1	UTSW	10	5220359	missense	probably damaging	1.00
R9505:Syne1	UTSW	10	5030394	missense	probably benign	0.00
R9509:Syne1	UTSW	10	5348927	critical splice donor site	probably null
R9546:Syne1	UTSW	10	5243123	missense	probably damaging	1.00
R9567:Syne1	UTSW	10	5246386	missense	possibly damaging	0.54
R9601:Syne1	UTSW	10	5259270	missense	probably benign	0.23
R9619:Syne1	UTSW	10	5140909	missense	probably benign	0.03
R9621:Syne1	UTSW	10	5323887	missense	probably benign	0.01
R9623:Syne1	UTSW	10	5202009	missense	probably damaging	1.00
R9646:Syne1	UTSW	10	5229187	missense	possibly damaging	0.95
R9666:Syne1	UTSW	10	5034937	missense	probably damaging	1.00
R9677:Syne1	UTSW	10	5265125	missense	probably damaging	1.00
R9695:Syne1	UTSW	10	5318461	missense	probably benign	0.03
R9696:Syne1	UTSW	10	5347847	missense	probably benign	0.00
R9719:Syne1	UTSW	10	5326601	missense	possibly damaging	0.47
R9744:Syne1	UTSW	10	5324184	missense	probably benign	0.01
R9761:Syne1	UTSW	10	5368190	critical splice donor site	probably null
R9763:Syne1	UTSW	10	5057858	missense	probably benign	0.31
RF010:Syne1	UTSW	10	5246386	missense	possibly damaging	0.89
RF015:Syne1	UTSW	10	5302248	missense	probably benign	0.01
RF023:Syne1	UTSW	10	5255482	missense	probably damaging	1.00
X0017:Syne1	UTSW	10	5346917	missense	probably damaging	1.00
X0025:Syne1	UTSW	10	5358973	nonsense	probably null
X0063:Syne1	UTSW	10	5052354	missense	probably damaging	1.00
Z1176:Syne1	UTSW	10	5248364	missense	probably damaging	0.96
Z1176:Syne1	UTSW	10	5259280	missense	probably benign
Z1176:Syne1	UTSW	10	5330251	missense	probably benign	0.10
Z1177:Syne1	UTSW	10	5143230	missense	possibly damaging	0.78
Z1177:Syne1	UTSW	10	5259349	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACACAGAACCTATTTGTCCCC -3'
(R):5'- ACTGGCTTCTCCACATGAGG -3'

Sequencing Primer
(F):5'- ACTTTCCTACACAGAGCTCCC -3'
(R):5'- GCTTCTCCACATGAGGGTAACATG -3'

Posted On

2017-10-10