Incidental Mutation 'R6164:Prdm1'
ID490058
Institutional Source Beutler Lab
Gene Symbol Prdm1
Ensembl Gene ENSMUSG00000038151
Gene NamePR domain containing 1, with ZNF domain
SynonymsBlimp1, b2b1765Clo, Blimp-1, PRDI-BF1
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location44437177-44528501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44450195 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 126 (R126H)
Ref Sequence ENSEMBL: ENSMUSP00000151237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]
Predicted Effect probably damaging
Transcript: ENSMUST00000039174
AA Change: R144H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: R144H

DomainStartEndE-ValueType
SET 118 239 1.1e-19 SMART
low complexity region 359 393 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
ZnF_C2H2 606 628 6.42e-4 SMART
ZnF_C2H2 634 656 3.89e-3 SMART
ZnF_C2H2 662 684 7.26e-3 SMART
ZnF_C2H2 690 712 1.36e-2 SMART
ZnF_C2H2 718 738 1.12e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105490
AA Change: R111H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: R111H

DomainStartEndE-ValueType
SET 85 206 1.1e-19 SMART
low complexity region 326 360 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
ZnF_C2H2 573 595 6.42e-4 SMART
ZnF_C2H2 601 623 3.89e-3 SMART
ZnF_C2H2 629 651 7.26e-3 SMART
ZnF_C2H2 657 679 1.36e-2 SMART
ZnF_C2H2 685 705 1.12e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167340
Predicted Effect probably damaging
Transcript: ENSMUST00000218369
AA Change: R126H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9361 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Prdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Prdm1 APN 10 44441892 missense probably damaging 1.00
IGL01331:Prdm1 APN 10 44441974 missense possibly damaging 0.67
IGL02064:Prdm1 APN 10 44441342 missense probably damaging 1.00
IGL02669:Prdm1 APN 10 44439884 missense probably benign 0.28
IGL02944:Prdm1 APN 10 44441811 missense probably benign
IGL03295:Prdm1 APN 10 44439870 missense probably damaging 0.99
PIT4576001:Prdm1 UTSW 10 44458508 start codon destroyed probably null 0.05
R0008:Prdm1 UTSW 10 44441679 missense probably damaging 1.00
R0166:Prdm1 UTSW 10 44440091 missense probably damaging 1.00
R0226:Prdm1 UTSW 10 44456696 missense probably benign 0.03
R0284:Prdm1 UTSW 10 44456626 missense probably damaging 1.00
R0398:Prdm1 UTSW 10 44439809 missense probably damaging 1.00
R1200:Prdm1 UTSW 10 44450130 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1438:Prdm1 UTSW 10 44442128 missense probably benign 0.00
R1519:Prdm1 UTSW 10 44439986 nonsense probably null
R1886:Prdm1 UTSW 10 44439758 missense probably damaging 0.99
R2070:Prdm1 UTSW 10 44441412 missense possibly damaging 0.82
R2508:Prdm1 UTSW 10 44446807 missense probably benign 0.37
R3087:Prdm1 UTSW 10 44446827 missense probably damaging 1.00
R3150:Prdm1 UTSW 10 44458492 splice site probably null
R4165:Prdm1 UTSW 10 44441576 missense probably benign 0.11
R4490:Prdm1 UTSW 10 44446907 nonsense probably null
R4647:Prdm1 UTSW 10 44439690 missense probably damaging 0.98
R4911:Prdm1 UTSW 10 44442052 missense possibly damaging 0.90
R4925:Prdm1 UTSW 10 44440169 missense probably damaging 1.00
R5153:Prdm1 UTSW 10 44450225 missense possibly damaging 0.94
R5247:Prdm1 UTSW 10 44440102 missense probably damaging 1.00
R5792:Prdm1 UTSW 10 44450228 missense probably damaging 1.00
R6247:Prdm1 UTSW 10 44446786 splice site probably null
R7196:Prdm1 UTSW 10 44456992 missense probably benign 0.14
R7270:Prdm1 UTSW 10 44441570 missense probably benign 0.07
R7384:Prdm1 UTSW 10 44458507 missense probably benign 0.01
R7822:Prdm1 UTSW 10 44458482 missense probably benign 0.01
Z1088:Prdm1 UTSW 10 44441925 missense probably damaging 1.00
Z1176:Prdm1 UTSW 10 44446833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAACTTGCTCAGAATTCC -3'
(R):5'- AAACGATGACTGTCACGAAGC -3'

Sequencing Primer
(F):5'- CAGAATTCCAGTGTTTCCCTGGG -3'
(R):5'- TGCCATCTCAGAGTCTGA -3'
Posted On2017-10-10