Incidental Mutation 'R6164:Pik3r6'
ID 490062
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Name phosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68503019-68552698 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68551973 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 730 (T730A)
Ref Sequence ENSEMBL: ENSMUSP00000099673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053211] [ENSMUST00000060441] [ENSMUST00000102613]
AlphaFold Q3U6Q4
Predicted Effect probably benign
Transcript: ENSMUST00000053211
SMART Domains Protein: ENSMUSP00000061601
Gene: ENSMUSG00000048329

DomainStartEndE-ValueType
Pfam:MFS_1_like 28 88 1.6e-7 PFAM
transmembrane domain 284 303 N/A INTRINSIC
transmembrane domain 318 340 N/A INTRINSIC
Pfam:MFS_1 365 555 4e-11 PFAM
low complexity region 557 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: T734A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: T734A

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: T730A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: T730A

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam122a T A 19: 24,477,086 M91L probably benign Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68534251 missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68551321 missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68533619 missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68528826 critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68531450 missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68526412 missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68527105 missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68544750 missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68526408 nonsense probably null
R0454:Pik3r6 UTSW 11 68528782 missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68536101 splice site probably benign
R1119:Pik3r6 UTSW 11 68545872 missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68531445 missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68536106 missense probably benign
R1831:Pik3r6 UTSW 11 68544034 missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68543611 nonsense probably null
R4013:Pik3r6 UTSW 11 68533521 missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68544775 missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68529894 missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68544053 splice site probably benign
R4974:Pik3r6 UTSW 11 68539945 missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68533468 nonsense probably null
R5787:Pik3r6 UTSW 11 68539927 missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68525671 nonsense probably null
R6192:Pik3r6 UTSW 11 68543629 missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68533696 missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68533875 missense probably benign 0.00
R7964:Pik3r6 UTSW 11 68533739 missense probably benign 0.01
R8473:Pik3r6 UTSW 11 68526381 missense probably benign 0.02
R8515:Pik3r6 UTSW 11 68539957 missense probably damaging 1.00
R8883:Pik3r6 UTSW 11 68533642 missense probably benign
R9545:Pik3r6 UTSW 11 68531539 missense probably damaging 1.00
R9623:Pik3r6 UTSW 11 68551333 missense possibly damaging 0.55
R9762:Pik3r6 UTSW 11 68533532 nonsense probably null
W0251:Pik3r6 UTSW 11 68533871 missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68525602 missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68520200 start gained probably benign
Z1176:Pik3r6 UTSW 11 68544765 missense probably benign 0.12
Z1177:Pik3r6 UTSW 11 68551227 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTGCAACATGAGGACCTC -3'
(R):5'- ATTCTCTGGCTCCTGGTCCAAG -3'

Sequencing Primer
(F):5'- GTTCCCTATAAAAGTTGCTCTACC -3'
(R):5'- TCCTGGTCCAAGCAGAGCTG -3'
Posted On 2017-10-10