Incidental Mutation 'R6164:Pik3r6'
ID 490062
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Name phosphoinositide-3-kinase regulatory subunit 5
Synonyms p87PIKAP, p84 Pikap
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68393845-68443524 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68442799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 730 (T730A)
Ref Sequence ENSEMBL: ENSMUSP00000099673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053211] [ENSMUST00000060441] [ENSMUST00000102613]
AlphaFold Q3U6Q4
Predicted Effect probably benign
Transcript: ENSMUST00000053211
SMART Domains Protein: ENSMUSP00000061601
Gene: ENSMUSG00000048329

DomainStartEndE-ValueType
Pfam:MFS_1_like 28 88 1.6e-7 PFAM
transmembrane domain 284 303 N/A INTRINSIC
transmembrane domain 318 340 N/A INTRINSIC
Pfam:MFS_1 365 555 4e-11 PFAM
low complexity region 557 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: T734A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: T734A

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: T730A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: T730A

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anpep A G 7: 79,491,953 (GRCm39) I16T possibly damaging Het
Ap1s1 T C 5: 137,066,240 (GRCm39) probably benign Het
Atp1a2 T C 1: 172,106,459 (GRCm39) S848G probably damaging Het
Bche T A 3: 73,608,389 (GRCm39) I346F possibly damaging Het
Ccdc148 T A 2: 58,713,645 (GRCm39) Y502F probably damaging Het
Ccdc88c T C 12: 100,919,642 (GRCm39) M416V probably damaging Het
Cdk17 T C 10: 93,071,331 (GRCm39) S351P probably benign Het
Cfap100 T C 6: 90,392,768 (GRCm39) E114G probably benign Het
Clec4a4 T C 6: 122,968,833 (GRCm39) I66T possibly damaging Het
Cpeb4 T C 11: 31,870,584 (GRCm39) probably null Het
Cybrd1 T C 2: 70,948,618 (GRCm39) V52A probably damaging Het
Decr1 G A 4: 15,924,347 (GRCm39) A191V probably benign Het
Dnah5 A T 15: 28,378,489 (GRCm39) I2942L probably benign Het
Ehd4 C T 2: 119,932,689 (GRCm39) V246I possibly damaging Het
Ercc6l2 A G 13: 64,020,158 (GRCm39) probably benign Het
Exoc4 T A 6: 33,309,218 (GRCm39) M280K probably damaging Het
Fmo1 T G 1: 162,678,979 (GRCm39) E89A probably benign Het
Foxm1 A G 6: 128,350,898 (GRCm39) D733G probably benign Het
Garin5b T C 7: 4,773,677 (GRCm39) T73A probably damaging Het
Gulp1 A C 1: 44,793,511 (GRCm39) R57S probably damaging Het
Hdac1-ps T C 17: 78,799,716 (GRCm39) S236P probably damaging Het
Hdac4 G T 1: 91,957,876 (GRCm39) A46E probably benign Het
Hspg2 T C 4: 137,241,966 (GRCm39) S567P possibly damaging Het
Insyn1 C A 9: 58,406,530 (GRCm39) P147T probably damaging Het
Iqgap1 A C 7: 80,458,854 (GRCm39) C21W unknown Het
Isoc2a T C 7: 4,894,488 (GRCm39) L57P probably damaging Het
Krt34 G A 11: 99,929,272 (GRCm39) Q313* probably null Het
Krt6a C T 15: 101,601,008 (GRCm39) V263I probably damaging Het
Man2a1 A G 17: 65,040,719 (GRCm39) I106V possibly damaging Het
Muc16 T C 9: 18,469,675 (GRCm39) D7300G probably damaging Het
Muc5b A T 7: 141,417,082 (GRCm39) S3343C possibly damaging Het
Mup11 C T 4: 60,618,239 (GRCm39) E21K possibly damaging Het
Myo3b T A 2: 70,075,754 (GRCm39) probably null Het
Nlrp4c T C 7: 6,095,507 (GRCm39) L795P probably damaging Het
Nup160 T A 2: 90,548,220 (GRCm39) Y984* probably null Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or2d3 G T 7: 106,491,135 (GRCm39) Y60* probably null Het
Or5p52 A G 7: 107,502,595 (GRCm39) T224A probably benign Het
Osmr A G 15: 6,889,833 (GRCm39) V5A probably benign Het
Pabir1 T A 19: 24,454,450 (GRCm39) M91L probably benign Het
Pcsk5 A G 19: 17,814,317 (GRCm39) probably null Het
Pex11a G A 7: 79,387,127 (GRCm39) T235M probably damaging Het
Ppp1r9a C T 6: 5,110,715 (GRCm39) probably benign Het
Ppp2r2d T C 7: 138,474,742 (GRCm39) I41T probably damaging Het
Prdm1 C T 10: 44,326,191 (GRCm39) R126H probably damaging Het
Primpol C T 8: 47,039,477 (GRCm39) R381H probably benign Het
Prl7a1 C A 13: 27,821,626 (GRCm39) Q102H probably benign Het
Rbpjl T C 2: 164,252,799 (GRCm39) L284P probably damaging Het
Rgs21 A T 1: 144,417,035 (GRCm39) C6S probably benign Het
Rnasel T C 1: 153,630,138 (GRCm39) V218A probably benign Het
Sag G T 1: 87,752,175 (GRCm39) V223L probably damaging Het
Sdk1 C T 5: 142,117,824 (GRCm39) T1574M probably damaging Het
Secisbp2 G A 13: 51,833,896 (GRCm39) V679M probably damaging Het
Sele T A 1: 163,879,386 (GRCm39) probably null Het
Senp7 T A 16: 55,990,117 (GRCm39) L622M probably damaging Het
Sgo1 G A 17: 53,983,981 (GRCm39) R466C probably damaging Het
Sh3tc1 C A 5: 35,863,590 (GRCm39) V866L probably benign Het
Snrnp25 T A 11: 32,157,647 (GRCm39) V75D probably benign Het
Syne1 C T 10: 5,011,429 (GRCm39) C7899Y probably damaging Het
U2af1l4 T C 7: 30,264,007 (GRCm39) S55P probably damaging Het
Vmn1r23 A G 6: 57,903,040 (GRCm39) I246T possibly damaging Het
Vmn1r66 T A 7: 10,008,329 (GRCm39) R235* probably null Het
Wnk4 C T 11: 101,165,894 (GRCm39) A807V possibly damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68,425,077 (GRCm39) missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68,442,147 (GRCm39) missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68,424,445 (GRCm39) missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68,419,652 (GRCm39) critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68,422,276 (GRCm39) missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68,417,238 (GRCm39) missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68,417,931 (GRCm39) missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68,435,576 (GRCm39) missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68,419,635 (GRCm39) missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68,419,635 (GRCm39) missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68,417,234 (GRCm39) nonsense probably null
R0454:Pik3r6 UTSW 11 68,419,608 (GRCm39) missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68,426,927 (GRCm39) splice site probably benign
R1119:Pik3r6 UTSW 11 68,436,698 (GRCm39) missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68,422,271 (GRCm39) missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68,426,932 (GRCm39) missense probably benign
R1831:Pik3r6 UTSW 11 68,434,860 (GRCm39) missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68,434,437 (GRCm39) nonsense probably null
R4013:Pik3r6 UTSW 11 68,424,347 (GRCm39) missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68,435,601 (GRCm39) missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68,420,720 (GRCm39) missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68,434,879 (GRCm39) splice site probably benign
R4974:Pik3r6 UTSW 11 68,430,771 (GRCm39) missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68,424,294 (GRCm39) nonsense probably null
R5787:Pik3r6 UTSW 11 68,430,753 (GRCm39) missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68,416,497 (GRCm39) nonsense probably null
R6192:Pik3r6 UTSW 11 68,434,455 (GRCm39) missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68,424,522 (GRCm39) missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68,419,389 (GRCm39) missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68,419,389 (GRCm39) missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68,424,701 (GRCm39) missense probably benign 0.00
R7964:Pik3r6 UTSW 11 68,424,565 (GRCm39) missense probably benign 0.01
R8473:Pik3r6 UTSW 11 68,417,207 (GRCm39) missense probably benign 0.02
R8515:Pik3r6 UTSW 11 68,430,783 (GRCm39) missense probably damaging 1.00
R8883:Pik3r6 UTSW 11 68,424,468 (GRCm39) missense probably benign
R9545:Pik3r6 UTSW 11 68,422,365 (GRCm39) missense probably damaging 1.00
R9623:Pik3r6 UTSW 11 68,442,159 (GRCm39) missense possibly damaging 0.55
R9762:Pik3r6 UTSW 11 68,424,358 (GRCm39) nonsense probably null
W0251:Pik3r6 UTSW 11 68,424,697 (GRCm39) missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68,416,428 (GRCm39) missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68,435,591 (GRCm39) missense probably benign 0.12
Z1176:Pik3r6 UTSW 11 68,411,026 (GRCm39) start gained probably benign
Z1177:Pik3r6 UTSW 11 68,442,053 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTGCAACATGAGGACCTC -3'
(R):5'- ATTCTCTGGCTCCTGGTCCAAG -3'

Sequencing Primer
(F):5'- GTTCCCTATAAAAGTTGCTCTACC -3'
(R):5'- TCCTGGTCCAAGCAGAGCTG -3'
Posted On 2017-10-10