Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Ccdc88c'

490065

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88c

Ensembl Gene

ENSMUSG00000021182

Gene Name

coiled-coil domain containing 88C

Synonyms

0610010D24Rik, Daple

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100911523-101029056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100953383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 416 (M416V)

Ref Sequence

ENSEMBL: ENSMUSP00000082177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096]

AlphaFold

Q6VGS5

Predicted Effect

probably damaging
Transcript: ENSMUST00000068411
AA Change: M416V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: M416V

Domain	Start	End	E-Value	Type
Pfam:HOOK	7	586	5.9e-37	PFAM
low complexity region	601	613	N/A	INTRINSIC
low complexity region	617	634	N/A	INTRINSIC
Blast:BRLZ	668	719	3e-8	BLAST
low complexity region	724	744	N/A	INTRINSIC
low complexity region	827	837	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
Blast:BRLZ	948	1007	6e-15	BLAST
coiled coil region	1035	1085	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
coiled coil region	1129	1252	N/A	INTRINSIC
coiled coil region	1312	1384	N/A	INTRINSIC
low complexity region	1430	1439	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
low complexity region	1698	1709	N/A	INTRINSIC
internal_repeat_1	1721	1778	6.97e-6	PROSPERO
low complexity region	1788	1808	N/A	INTRINSIC
internal_repeat_1	1934	1989	6.97e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000085096
AA Change: M416V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: M416V

Domain	Start	End	E-Value	Type
Pfam:HOOK	13	597	2.5e-41	PFAM
low complexity region	608	620	N/A	INTRINSIC
low complexity region	624	641	N/A	INTRINSIC
Blast:BRLZ	675	726	3e-8	BLAST
low complexity region	731	751	N/A	INTRINSIC
low complexity region	834	844	N/A	INTRINSIC
low complexity region	854	873	N/A	INTRINSIC
Blast:BRLZ	955	1014	5e-15	BLAST
coiled coil region	1042	1092	N/A	INTRINSIC
low complexity region	1102	1117	N/A	INTRINSIC
coiled coil region	1136	1259	N/A	INTRINSIC
coiled coil region	1319	1391	N/A	INTRINSIC
low complexity region	1437	1446	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1569	1590	N/A	INTRINSIC
low complexity region	1705	1716	N/A	INTRINSIC
internal_repeat_1	1728	1785	6.57e-6	PROSPERO
low complexity region	1795	1815	N/A	INTRINSIC
internal_repeat_1	1941	1996	6.57e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180617

Meta Mutation Damage Score

0.1732

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Ccdc88c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ccdc88c	APN	12	100916803	missense	probably benign	0.04
IGL02016:Ccdc88c	APN	12	100941207	missense	possibly damaging	0.63
IGL02031:Ccdc88c	APN	12	100933311	missense	probably damaging	0.98
IGL02133:Ccdc88c	APN	12	100940090	missense	probably damaging	1.00
IGL02427:Ccdc88c	APN	12	100921592	missense	probably damaging	1.00
IGL02494:Ccdc88c	APN	12	100945475	missense	probably benign
IGL02496:Ccdc88c	APN	12	100953293	missense	probably benign	0.05
IGL02549:Ccdc88c	APN	12	100928932	missense	probably benign	0.18
IGL02618:Ccdc88c	APN	12	100913553	missense	probably benign	0.28
IGL02626:Ccdc88c	APN	12	100967800	unclassified	probably benign
IGL03142:Ccdc88c	APN	12	100947198	missense	probably damaging	1.00
BB010:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
BB020:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R0127:Ccdc88c	UTSW	12	100935740	missense	possibly damaging	0.88
R0533:Ccdc88c	UTSW	12	100954282	missense	probably damaging	1.00
R0545:Ccdc88c	UTSW	12	100947188	missense	probably damaging	1.00
R0866:Ccdc88c	UTSW	12	100913192	missense	probably benign	0.01
R1230:Ccdc88c	UTSW	12	100948488	missense	probably benign	0.00
R1434:Ccdc88c	UTSW	12	100939166	splice site	probably benign
R1614:Ccdc88c	UTSW	12	100912984	missense	probably benign	0.00
R1644:Ccdc88c	UTSW	12	100913474	missense	probably damaging	0.98
R1712:Ccdc88c	UTSW	12	100939025	missense	probably benign	0.14
R2107:Ccdc88c	UTSW	12	100921549	missense	probably benign
R3612:Ccdc88c	UTSW	12	100939073	missense	probably damaging	0.99
R3724:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3737:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3743:Ccdc88c	UTSW	12	100948584	missense	probably damaging	1.00
R3772:Ccdc88c	UTSW	12	100966100	unclassified	probably benign
R3776:Ccdc88c	UTSW	12	100947179	missense	probably damaging	0.97
R3917:Ccdc88c	UTSW	12	100941107	critical splice donor site	probably null
R4034:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4035:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4110:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4113:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4270:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4271:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4520:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4521:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4522:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4523:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4524:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4717:Ccdc88c	UTSW	12	100916666	missense	probably benign	0.00
R4821:Ccdc88c	UTSW	12	100938079	missense	probably benign	0.00
R4823:Ccdc88c	UTSW	12	100930543	missense	probably damaging	1.00
R5090:Ccdc88c	UTSW	12	100954180	missense	probably damaging	1.00
R5510:Ccdc88c	UTSW	12	100945031	missense	probably damaging	1.00
R5514:Ccdc88c	UTSW	12	100913439	missense	probably damaging	1.00
R5903:Ccdc88c	UTSW	12	100930542	missense	probably damaging	1.00
R5999:Ccdc88c	UTSW	12	100968354	missense	probably damaging	1.00
R6131:Ccdc88c	UTSW	12	100941128	missense	probably damaging	1.00
R6971:Ccdc88c	UTSW	12	100954227	missense	probably damaging	1.00
R6998:Ccdc88c	UTSW	12	100916852	missense	probably damaging	0.96
R7031:Ccdc88c	UTSW	12	100945064	missense	probably damaging	1.00
R7240:Ccdc88c	UTSW	12	100944939	missense	probably benign	0.17
R7366:Ccdc88c	UTSW	12	100944950	missense	possibly damaging	0.89
R7604:Ccdc88c	UTSW	12	100930547	missense	probably damaging	1.00
R7674:Ccdc88c	UTSW	12	100945232	missense	probably benign	0.00
R7795:Ccdc88c	UTSW	12	100923311	missense	probably benign	0.32
R7933:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R7990:Ccdc88c	UTSW	12	100967985	missense	probably damaging	1.00
R8339:Ccdc88c	UTSW	12	100941140	nonsense	probably null
R8734:Ccdc88c	UTSW	12	100940135	missense	probably damaging	1.00
R8778:Ccdc88c	UTSW	12	100945224	missense	probably benign	0.25
R8925:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R8927:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R9014:Ccdc88c	UTSW	12	100913064	missense	probably benign	0.09
R9204:Ccdc88c	UTSW	12	100938063	missense	unknown
R9257:Ccdc88c	UTSW	12	100923215	missense	possibly damaging	0.94
R9326:Ccdc88c	UTSW	12	101028850	start gained	probably benign
R9424:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R9439:Ccdc88c	UTSW	12	100918338	missense	probably benign	0.25
R9539:Ccdc88c	UTSW	12	100935734	missense	possibly damaging	0.89
R9576:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
Z1176:Ccdc88c	UTSW	12	100945770	missense	possibly damaging	0.69
Z1177:Ccdc88c	UTSW	12	100945155	missense	probably benign
Z1190:Ccdc88c	UTSW	12	100923332	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAATGGCACTTGAGGAAATC -3'
(R):5'- GGACTTCCTTCTTGACCTAAGTAG -3'

Sequencing Primer
(F):5'- TTGCTAGGAAGACTCGGAGCC -3'
(R):5'- AGAAATGTTATAGCTCTCTCTCTGTC -3'

Posted On

2017-10-10