Incidental Mutation 'R6164:Sgo1'
ID 490073
Institutional Source Beutler Lab
Gene Symbol Sgo1
Ensembl Gene ENSMUSG00000023940
Gene Name shugoshin 1
Synonyms Sgol1, 3300001M08Rik
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 53981814-53996361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53983981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 466 (R466C)
Ref Sequence ENSEMBL: ENSMUSP00000024736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000024736] [ENSMUST00000166525]
AlphaFold Q9CXH7
Predicted Effect probably benign
Transcript: ENSMUST00000000724
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000024736
AA Change: R466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024736
Gene: ENSMUSG00000023940
AA Change: R466C

DomainStartEndE-ValueType
Pfam:Shugoshin_N 22 66 6.2e-12 PFAM
low complexity region 273 290 N/A INTRINSIC
Pfam:Shugoshin_C 463 486 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166525
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the shugoshin family of proteins. This protein is thought to protect centromeric cohesin from cleavage during mitotic prophase by preventing phosphorylation of a cohesin subunit. Reduced expression of this gene leads to the premature loss of centromeric cohesion, mis-segregation of sister chromatids, and mitotic arrest. Evidence suggests that this protein also protects a small subset of cohesin found along the length of the chromosome arms during mitotic prophase. An isoform lacking exon 6 has been shown to play a role in the cohesion of centrioles (PMID: 16582621 and PMID:18331714). Mutations in this gene have been associated with Chronic Atrial and Intestinal Dysrhythmia (CAID) syndrome, characterized by the co-occurrence of Sick Sinus Syndrome (SSS) and Chronic Intestinal Pseudo-obstruction (CIPO) within the first four decades of life (PMID:25282101). Fibroblast cells from CAID patients exhibited both increased cell proliferation and higher rates of senescence. Pseudogenes of this gene have been found on chromosomes 1 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene-trapped allele show prenatal lethality. Heterozygotes display enhanced chromosome instability, as well as increased formation of aberrant crypt foci and accelerated development of colon tumors after exposure to azoxymethane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anpep A G 7: 79,491,953 (GRCm39) I16T possibly damaging Het
Ap1s1 T C 5: 137,066,240 (GRCm39) probably benign Het
Atp1a2 T C 1: 172,106,459 (GRCm39) S848G probably damaging Het
Bche T A 3: 73,608,389 (GRCm39) I346F possibly damaging Het
Ccdc148 T A 2: 58,713,645 (GRCm39) Y502F probably damaging Het
Ccdc88c T C 12: 100,919,642 (GRCm39) M416V probably damaging Het
Cdk17 T C 10: 93,071,331 (GRCm39) S351P probably benign Het
Cfap100 T C 6: 90,392,768 (GRCm39) E114G probably benign Het
Clec4a4 T C 6: 122,968,833 (GRCm39) I66T possibly damaging Het
Cpeb4 T C 11: 31,870,584 (GRCm39) probably null Het
Cybrd1 T C 2: 70,948,618 (GRCm39) V52A probably damaging Het
Decr1 G A 4: 15,924,347 (GRCm39) A191V probably benign Het
Dnah5 A T 15: 28,378,489 (GRCm39) I2942L probably benign Het
Ehd4 C T 2: 119,932,689 (GRCm39) V246I possibly damaging Het
Ercc6l2 A G 13: 64,020,158 (GRCm39) probably benign Het
Exoc4 T A 6: 33,309,218 (GRCm39) M280K probably damaging Het
Fmo1 T G 1: 162,678,979 (GRCm39) E89A probably benign Het
Foxm1 A G 6: 128,350,898 (GRCm39) D733G probably benign Het
Garin5b T C 7: 4,773,677 (GRCm39) T73A probably damaging Het
Gulp1 A C 1: 44,793,511 (GRCm39) R57S probably damaging Het
Hdac1-ps T C 17: 78,799,716 (GRCm39) S236P probably damaging Het
Hdac4 G T 1: 91,957,876 (GRCm39) A46E probably benign Het
Hspg2 T C 4: 137,241,966 (GRCm39) S567P possibly damaging Het
Insyn1 C A 9: 58,406,530 (GRCm39) P147T probably damaging Het
Iqgap1 A C 7: 80,458,854 (GRCm39) C21W unknown Het
Isoc2a T C 7: 4,894,488 (GRCm39) L57P probably damaging Het
Krt34 G A 11: 99,929,272 (GRCm39) Q313* probably null Het
Krt6a C T 15: 101,601,008 (GRCm39) V263I probably damaging Het
Man2a1 A G 17: 65,040,719 (GRCm39) I106V possibly damaging Het
Muc16 T C 9: 18,469,675 (GRCm39) D7300G probably damaging Het
Muc5b A T 7: 141,417,082 (GRCm39) S3343C possibly damaging Het
Mup11 C T 4: 60,618,239 (GRCm39) E21K possibly damaging Het
Myo3b T A 2: 70,075,754 (GRCm39) probably null Het
Nlrp4c T C 7: 6,095,507 (GRCm39) L795P probably damaging Het
Nup160 T A 2: 90,548,220 (GRCm39) Y984* probably null Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or2d3 G T 7: 106,491,135 (GRCm39) Y60* probably null Het
Or5p52 A G 7: 107,502,595 (GRCm39) T224A probably benign Het
Osmr A G 15: 6,889,833 (GRCm39) V5A probably benign Het
Pabir1 T A 19: 24,454,450 (GRCm39) M91L probably benign Het
Pcsk5 A G 19: 17,814,317 (GRCm39) probably null Het
Pex11a G A 7: 79,387,127 (GRCm39) T235M probably damaging Het
Pik3r6 A G 11: 68,442,799 (GRCm39) T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 (GRCm39) probably benign Het
Ppp2r2d T C 7: 138,474,742 (GRCm39) I41T probably damaging Het
Prdm1 C T 10: 44,326,191 (GRCm39) R126H probably damaging Het
Primpol C T 8: 47,039,477 (GRCm39) R381H probably benign Het
Prl7a1 C A 13: 27,821,626 (GRCm39) Q102H probably benign Het
Rbpjl T C 2: 164,252,799 (GRCm39) L284P probably damaging Het
Rgs21 A T 1: 144,417,035 (GRCm39) C6S probably benign Het
Rnasel T C 1: 153,630,138 (GRCm39) V218A probably benign Het
Sag G T 1: 87,752,175 (GRCm39) V223L probably damaging Het
Sdk1 C T 5: 142,117,824 (GRCm39) T1574M probably damaging Het
Secisbp2 G A 13: 51,833,896 (GRCm39) V679M probably damaging Het
Sele T A 1: 163,879,386 (GRCm39) probably null Het
Senp7 T A 16: 55,990,117 (GRCm39) L622M probably damaging Het
Sh3tc1 C A 5: 35,863,590 (GRCm39) V866L probably benign Het
Snrnp25 T A 11: 32,157,647 (GRCm39) V75D probably benign Het
Syne1 C T 10: 5,011,429 (GRCm39) C7899Y probably damaging Het
U2af1l4 T C 7: 30,264,007 (GRCm39) S55P probably damaging Het
Vmn1r23 A G 6: 57,903,040 (GRCm39) I246T possibly damaging Het
Vmn1r66 T A 7: 10,008,329 (GRCm39) R235* probably null Het
Wnk4 C T 11: 101,165,894 (GRCm39) A807V possibly damaging Het
Other mutations in Sgo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Sgo1 APN 17 53,984,130 (GRCm39) splice site probably benign
IGL00952:Sgo1 APN 17 53,994,275 (GRCm39) missense probably damaging 1.00
IGL02271:Sgo1 APN 17 53,986,567 (GRCm39) missense possibly damaging 0.62
IGL02457:Sgo1 APN 17 53,983,989 (GRCm39) missense probably damaging 1.00
R0049:Sgo1 UTSW 17 53,986,691 (GRCm39) missense probably damaging 0.97
R0049:Sgo1 UTSW 17 53,986,691 (GRCm39) missense probably damaging 0.97
R1836:Sgo1 UTSW 17 53,994,799 (GRCm39) missense probably damaging 1.00
R2989:Sgo1 UTSW 17 53,994,162 (GRCm39) missense probably benign 0.06
R6613:Sgo1 UTSW 17 53,986,085 (GRCm39) missense probably damaging 1.00
R7322:Sgo1 UTSW 17 53,984,085 (GRCm39) missense probably damaging 1.00
R7560:Sgo1 UTSW 17 53,986,295 (GRCm39) missense probably benign
R7767:Sgo1 UTSW 17 53,986,639 (GRCm39) missense possibly damaging 0.74
R9271:Sgo1 UTSW 17 53,983,931 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TACGAGTTTGAAGTCAGCACAGG -3'
(R):5'- CACTGATTATGAAGTGCCAGATATG -3'

Sequencing Primer
(F):5'- GTTTGAAGTCAGCACAGGATTATGC -3'
(R):5'- AAGTGCCAGATATGTTTTGTGTTTAC -3'
Posted On 2017-10-10