Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Sgo1'

490073

Institutional Source

Beutler Lab

Gene Symbol

Sgo1

Ensembl Gene

ENSMUSG00000023940

Gene Name

shugoshin 1

Synonyms

3300001M08Rik, Sgol1

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53674786-53689333 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53676953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 466 (R466C)

Ref Sequence

ENSEMBL: ENSMUSP00000024736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000024736] [ENSMUST00000166525]

AlphaFold

Q9CXH7

Predicted Effect

probably benign
Transcript: ENSMUST00000000724

SMART Domains

Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
low complexity region	32	55	N/A	INTRINSIC
Pfam:PCAF_N	56	308	6.2e-114	PFAM
low complexity region	461	472	N/A	INTRINSIC
Pfam:Acetyltransf_7	522	605	1.5e-11	PFAM
Pfam:Acetyltransf_1	530	604	3.2e-11	PFAM
low complexity region	643	659	N/A	INTRINSIC
BROMO	702	810	1.08e-44	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000024736
AA Change: R466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024736
Gene: ENSMUSG00000023940
AA Change: R466C

Domain	Start	End	E-Value	Type
Pfam:Shugoshin_N	22	66	6.2e-12	PFAM
low complexity region	273	290	N/A	INTRINSIC
Pfam:Shugoshin_C	463	486	2.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166525

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the shugoshin family of proteins. This protein is thought to protect centromeric cohesin from cleavage during mitotic prophase by preventing phosphorylation of a cohesin subunit. Reduced expression of this gene leads to the premature loss of centromeric cohesion, mis-segregation of sister chromatids, and mitotic arrest. Evidence suggests that this protein also protects a small subset of cohesin found along the length of the chromosome arms during mitotic prophase. An isoform lacking exon 6 has been shown to play a role in the cohesion of centrioles (PMID: 16582621 and PMID:18331714). Mutations in this gene have been associated with Chronic Atrial and Intestinal Dysrhythmia (CAID) syndrome, characterized by the co-occurrence of Sick Sinus Syndrome (SSS) and Chronic Intestinal Pseudo-obstruction (CIPO) within the first four decades of life (PMID:25282101). Fibroblast cells from CAID patients exhibited both increased cell proliferation and higher rates of senescence. Pseudogenes of this gene have been found on chromosomes 1 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene-trapped allele show prenatal lethality. Heterozygotes display enhanced chromosome instability, as well as increased formation of aberrant crypt foci and accelerated development of colon tumors after exposure to azoxymethane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp1r9a	C	T	6: 5,110,715		probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Sgo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Sgo1	APN	17	53677102	splice site	probably benign
IGL00952:Sgo1	APN	17	53687247	missense	probably damaging	1.00
IGL02271:Sgo1	APN	17	53679539	missense	possibly damaging	0.62
IGL02457:Sgo1	APN	17	53676961	missense	probably damaging	1.00
R0049:Sgo1	UTSW	17	53679663	missense	probably damaging	0.97
R0049:Sgo1	UTSW	17	53679663	missense	probably damaging	0.97
R1836:Sgo1	UTSW	17	53687771	missense	probably damaging	1.00
R2989:Sgo1	UTSW	17	53687134	missense	probably benign	0.06
R6613:Sgo1	UTSW	17	53679057	missense	probably damaging	1.00
R7322:Sgo1	UTSW	17	53677057	missense	probably damaging	1.00
R7560:Sgo1	UTSW	17	53679267	missense	probably benign
R7767:Sgo1	UTSW	17	53679611	missense	possibly damaging	0.74
R9271:Sgo1	UTSW	17	53676903	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TACGAGTTTGAAGTCAGCACAGG -3'
(R):5'- CACTGATTATGAAGTGCCAGATATG -3'

Sequencing Primer
(F):5'- GTTTGAAGTCAGCACAGGATTATGC -3'
(R):5'- AAGTGCCAGATATGTTTTGTGTTTAC -3'

Posted On

2017-10-10