Incidental Mutation 'R6164:Man2a1'
ID 490074
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Name mannosidase 2, alpha 1
Synonyms Map-2, Mana-2, Mana2
MMRRC Submission 044310-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.876) question?
Stock # R6164 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 64907731-65062105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65040719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 106 (I106V)
Ref Sequence ENSEMBL: ENSMUSP00000130529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723] [ENSMUST00000169668]
AlphaFold P27046
Predicted Effect probably benign
Transcript: ENSMUST00000086723
AA Change: I902V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: I902V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169668
AA Change: I106V

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130529
Gene: ENSMUSG00000024085
AA Change: I106V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 1 268 1.6e-50 PFAM
Meta Mutation Damage Score 0.1498 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anpep A G 7: 79,491,953 (GRCm39) I16T possibly damaging Het
Ap1s1 T C 5: 137,066,240 (GRCm39) probably benign Het
Atp1a2 T C 1: 172,106,459 (GRCm39) S848G probably damaging Het
Bche T A 3: 73,608,389 (GRCm39) I346F possibly damaging Het
Ccdc148 T A 2: 58,713,645 (GRCm39) Y502F probably damaging Het
Ccdc88c T C 12: 100,919,642 (GRCm39) M416V probably damaging Het
Cdk17 T C 10: 93,071,331 (GRCm39) S351P probably benign Het
Cfap100 T C 6: 90,392,768 (GRCm39) E114G probably benign Het
Clec4a4 T C 6: 122,968,833 (GRCm39) I66T possibly damaging Het
Cpeb4 T C 11: 31,870,584 (GRCm39) probably null Het
Cybrd1 T C 2: 70,948,618 (GRCm39) V52A probably damaging Het
Decr1 G A 4: 15,924,347 (GRCm39) A191V probably benign Het
Dnah5 A T 15: 28,378,489 (GRCm39) I2942L probably benign Het
Ehd4 C T 2: 119,932,689 (GRCm39) V246I possibly damaging Het
Ercc6l2 A G 13: 64,020,158 (GRCm39) probably benign Het
Exoc4 T A 6: 33,309,218 (GRCm39) M280K probably damaging Het
Fmo1 T G 1: 162,678,979 (GRCm39) E89A probably benign Het
Foxm1 A G 6: 128,350,898 (GRCm39) D733G probably benign Het
Garin5b T C 7: 4,773,677 (GRCm39) T73A probably damaging Het
Gulp1 A C 1: 44,793,511 (GRCm39) R57S probably damaging Het
Hdac1-ps T C 17: 78,799,716 (GRCm39) S236P probably damaging Het
Hdac4 G T 1: 91,957,876 (GRCm39) A46E probably benign Het
Hspg2 T C 4: 137,241,966 (GRCm39) S567P possibly damaging Het
Insyn1 C A 9: 58,406,530 (GRCm39) P147T probably damaging Het
Iqgap1 A C 7: 80,458,854 (GRCm39) C21W unknown Het
Isoc2a T C 7: 4,894,488 (GRCm39) L57P probably damaging Het
Krt34 G A 11: 99,929,272 (GRCm39) Q313* probably null Het
Krt6a C T 15: 101,601,008 (GRCm39) V263I probably damaging Het
Muc16 T C 9: 18,469,675 (GRCm39) D7300G probably damaging Het
Muc5b A T 7: 141,417,082 (GRCm39) S3343C possibly damaging Het
Mup11 C T 4: 60,618,239 (GRCm39) E21K possibly damaging Het
Myo3b T A 2: 70,075,754 (GRCm39) probably null Het
Nlrp4c T C 7: 6,095,507 (GRCm39) L795P probably damaging Het
Nup160 T A 2: 90,548,220 (GRCm39) Y984* probably null Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or2d3 G T 7: 106,491,135 (GRCm39) Y60* probably null Het
Or5p52 A G 7: 107,502,595 (GRCm39) T224A probably benign Het
Osmr A G 15: 6,889,833 (GRCm39) V5A probably benign Het
Pabir1 T A 19: 24,454,450 (GRCm39) M91L probably benign Het
Pcsk5 A G 19: 17,814,317 (GRCm39) probably null Het
Pex11a G A 7: 79,387,127 (GRCm39) T235M probably damaging Het
Pik3r6 A G 11: 68,442,799 (GRCm39) T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 (GRCm39) probably benign Het
Ppp2r2d T C 7: 138,474,742 (GRCm39) I41T probably damaging Het
Prdm1 C T 10: 44,326,191 (GRCm39) R126H probably damaging Het
Primpol C T 8: 47,039,477 (GRCm39) R381H probably benign Het
Prl7a1 C A 13: 27,821,626 (GRCm39) Q102H probably benign Het
Rbpjl T C 2: 164,252,799 (GRCm39) L284P probably damaging Het
Rgs21 A T 1: 144,417,035 (GRCm39) C6S probably benign Het
Rnasel T C 1: 153,630,138 (GRCm39) V218A probably benign Het
Sag G T 1: 87,752,175 (GRCm39) V223L probably damaging Het
Sdk1 C T 5: 142,117,824 (GRCm39) T1574M probably damaging Het
Secisbp2 G A 13: 51,833,896 (GRCm39) V679M probably damaging Het
Sele T A 1: 163,879,386 (GRCm39) probably null Het
Senp7 T A 16: 55,990,117 (GRCm39) L622M probably damaging Het
Sgo1 G A 17: 53,983,981 (GRCm39) R466C probably damaging Het
Sh3tc1 C A 5: 35,863,590 (GRCm39) V866L probably benign Het
Snrnp25 T A 11: 32,157,647 (GRCm39) V75D probably benign Het
Syne1 C T 10: 5,011,429 (GRCm39) C7899Y probably damaging Het
U2af1l4 T C 7: 30,264,007 (GRCm39) S55P probably damaging Het
Vmn1r23 A G 6: 57,903,040 (GRCm39) I246T possibly damaging Het
Vmn1r66 T A 7: 10,008,329 (GRCm39) R235* probably null Het
Wnk4 C T 11: 101,165,894 (GRCm39) A807V possibly damaging Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 65,017,700 (GRCm39) missense probably benign 0.00
IGL01823:Man2a1 APN 17 64,973,819 (GRCm39) missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64,973,894 (GRCm39) missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64,986,773 (GRCm39) missense probably benign 0.01
IGL03248:Man2a1 APN 17 65,020,606 (GRCm39) missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64,966,074 (GRCm39) splice site probably null
R0092:Man2a1 UTSW 17 64,966,079 (GRCm39) splice site probably benign
R1347:Man2a1 UTSW 17 65,019,445 (GRCm39) missense probably damaging 0.98
R1347:Man2a1 UTSW 17 65,019,445 (GRCm39) missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64,979,038 (GRCm39) missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64,979,038 (GRCm39) missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64,986,826 (GRCm39) missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 65,059,452 (GRCm39) missense probably benign 0.12
R1799:Man2a1 UTSW 17 64,976,492 (GRCm39) missense probably damaging 1.00
R1822:Man2a1 UTSW 17 65,047,837 (GRCm39) missense probably damaging 1.00
R1958:Man2a1 UTSW 17 65,057,830 (GRCm39) missense probably benign 0.00
R2852:Man2a1 UTSW 17 65,020,596 (GRCm39) missense probably benign 0.00
R4324:Man2a1 UTSW 17 64,973,788 (GRCm39) missense probably benign 0.00
R4582:Man2a1 UTSW 17 65,059,494 (GRCm39) missense probably benign 0.00
R4610:Man2a1 UTSW 17 65,019,454 (GRCm39) missense probably benign
R4803:Man2a1 UTSW 17 64,966,004 (GRCm39) missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64,966,074 (GRCm39) splice site probably null
R5109:Man2a1 UTSW 17 65,059,443 (GRCm39) missense probably benign 0.31
R5223:Man2a1 UTSW 17 65,019,266 (GRCm39) missense probably benign 0.17
R5229:Man2a1 UTSW 17 65,017,729 (GRCm39) missense probably benign 0.00
R5238:Man2a1 UTSW 17 64,943,502 (GRCm39) missense probably damaging 1.00
R5273:Man2a1 UTSW 17 65,040,780 (GRCm39) missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64,958,222 (GRCm39) missense probably damaging 0.99
R5352:Man2a1 UTSW 17 65,038,241 (GRCm39) missense probably damaging 1.00
R5428:Man2a1 UTSW 17 65,019,295 (GRCm39) missense probably benign 0.00
R5898:Man2a1 UTSW 17 64,932,375 (GRCm39) missense probably benign 0.01
R5942:Man2a1 UTSW 17 64,932,375 (GRCm39) missense probably benign 0.01
R5943:Man2a1 UTSW 17 64,932,375 (GRCm39) missense probably benign 0.01
R5963:Man2a1 UTSW 17 64,982,117 (GRCm39) missense probably benign
R5969:Man2a1 UTSW 17 64,932,375 (GRCm39) missense probably benign 0.01
R5970:Man2a1 UTSW 17 64,932,375 (GRCm39) missense probably benign 0.01
R6207:Man2a1 UTSW 17 65,020,600 (GRCm39) missense probably benign 0.02
R6245:Man2a1 UTSW 17 65,017,821 (GRCm39) missense probably damaging 0.97
R6724:Man2a1 UTSW 17 65,038,264 (GRCm39) missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64,932,383 (GRCm39) missense probably benign 0.00
R6778:Man2a1 UTSW 17 65,021,630 (GRCm39) missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64,943,583 (GRCm39) missense probably benign 0.00
R7354:Man2a1 UTSW 17 65,059,539 (GRCm39) missense probably damaging 1.00
R7833:Man2a1 UTSW 17 64,973,746 (GRCm39) missense probably damaging 0.99
R7991:Man2a1 UTSW 17 64,908,771 (GRCm39) missense probably benign 0.28
R8489:Man2a1 UTSW 17 64,908,765 (GRCm39) missense possibly damaging 0.64
R8540:Man2a1 UTSW 17 64,965,982 (GRCm39) missense probably benign
R8894:Man2a1 UTSW 17 65,020,596 (GRCm39) missense probably benign 0.00
R9447:Man2a1 UTSW 17 64,966,001 (GRCm39) missense possibly damaging 0.88
R9488:Man2a1 UTSW 17 65,040,734 (GRCm39) missense possibly damaging 0.80
R9526:Man2a1 UTSW 17 64,958,310 (GRCm39) missense probably benign 0.23
R9608:Man2a1 UTSW 17 65,041,953 (GRCm39) missense probably damaging 1.00
R9666:Man2a1 UTSW 17 64,943,557 (GRCm39) missense possibly damaging 0.78
RF007:Man2a1 UTSW 17 65,019,248 (GRCm39) missense probably damaging 0.98
Z1177:Man2a1 UTSW 17 65,042,049 (GRCm39) missense probably benign
Z1177:Man2a1 UTSW 17 64,966,015 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGTCTTCTGAGGGCCTTG -3'
(R):5'- CAGAAATGCTATGTAGTTCGAACTG -3'

Sequencing Primer
(F):5'- CCTTGTGGTTTCTCTGCATATG -3'
(R):5'- TCGAACTGCGAGCTTTCG -3'
Posted On 2017-10-10