Incidental Mutation 'R6164:Fam122a'
ID490077
Institutional Source Beutler Lab
Gene Symbol Fam122a
Ensembl Gene ENSMUSG00000074922
Gene Namefamily with sequence similarity 122, member A
Synonyms2900009I07Rik, Gm9849, 2410124L17Rik
MMRRC Submission 044310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.500) question?
Stock #R6164 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location24476502-24477356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24477086 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 91 (M91L)
Ref Sequence ENSEMBL: ENSMUSP00000097152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025800] [ENSMUST00000099556] [ENSMUST00000112673]
Predicted Effect probably benign
Transcript: ENSMUST00000025800
SMART Domains Protein: ENSMUSP00000025800
Gene: ENSMUSG00000024867

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 472 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099556
AA Change: M91L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097152
Gene: ENSMUSG00000074922
AA Change: M91L

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 163 187 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112673
SMART Domains Protein: ENSMUSP00000108292
Gene: ENSMUSG00000024867

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 420 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156814
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C A 9: 58,499,247 P147T probably damaging Het
Anpep A G 7: 79,842,205 I16T possibly damaging Het
Ap1s1 T C 5: 137,037,386 probably benign Het
Atp1a2 T C 1: 172,278,892 S848G probably damaging Het
Bche T A 3: 73,701,056 I346F possibly damaging Het
Ccdc148 T A 2: 58,823,633 Y502F probably damaging Het
Ccdc88c T C 12: 100,953,383 M416V probably damaging Het
Cdk17 T C 10: 93,235,469 S351P probably benign Het
Cfap100 T C 6: 90,415,786 E114G probably benign Het
Clec4a4 T C 6: 122,991,874 I66T possibly damaging Het
Cpeb4 T C 11: 31,920,584 probably null Het
Cybrd1 T C 2: 71,118,274 V52A probably damaging Het
Decr1 G A 4: 15,924,347 A191V probably benign Het
Dnah5 A T 15: 28,378,343 I2942L probably benign Het
Ehd4 C T 2: 120,102,208 V246I possibly damaging Het
Ercc6l2 A G 13: 63,872,344 probably benign Het
Exoc4 T A 6: 33,332,283 M280K probably damaging Het
Fam71e2 T C 7: 4,770,678 T73A probably damaging Het
Fmo1 T G 1: 162,851,410 E89A probably benign Het
Foxm1 A G 6: 128,373,935 D733G probably benign Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gulp1 A C 1: 44,754,351 R57S probably damaging Het
Hdac4 G T 1: 92,030,154 A46E probably benign Het
Hspg2 T C 4: 137,514,655 S567P possibly damaging Het
Iqgap1 A C 7: 80,809,106 C21W unknown Het
Isoc2a T C 7: 4,891,489 L57P probably damaging Het
Krt34 G A 11: 100,038,446 Q313* probably null Het
Krt6a C T 15: 101,692,573 V263I probably damaging Het
Man2a1 A G 17: 64,733,724 I106V possibly damaging Het
Muc16 T C 9: 18,558,379 D7300G probably damaging Het
Muc5b A T 7: 141,863,345 S3343C possibly damaging Het
Mup11 C T 4: 60,662,240 E21K possibly damaging Het
Myo3b T A 2: 70,245,410 probably null Het
Nlrp4c T C 7: 6,092,508 L795P probably damaging Het
Nup160 T A 2: 90,717,876 Y984* probably null Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr472 A G 7: 107,903,388 T224A probably benign Het
Olfr707 G T 7: 106,891,928 Y60* probably null Het
Osmr A G 15: 6,860,352 V5A probably benign Het
Pcsk5 A G 19: 17,836,953 probably null Het
Pex11a G A 7: 79,737,379 T235M probably damaging Het
Pik3r6 A G 11: 68,551,973 T730A probably benign Het
Ppp1r9a C T 6: 5,110,715 probably benign Het
Ppp2r2d T C 7: 138,873,013 I41T probably damaging Het
Prdm1 C T 10: 44,450,195 R126H probably damaging Het
Primpol C T 8: 46,586,442 R381H probably benign Het
Prl7a1 C A 13: 27,637,643 Q102H probably benign Het
Rbpjl T C 2: 164,410,879 L284P probably damaging Het
Rgs21 A T 1: 144,541,297 C6S probably benign Het
Rnasel T C 1: 153,754,392 V218A probably benign Het
Sag G T 1: 87,824,453 V223L probably damaging Het
Sdk1 C T 5: 142,132,069 T1574M probably damaging Het
Secisbp2 G A 13: 51,679,860 V679M probably damaging Het
Sele T A 1: 164,051,817 probably null Het
Senp7 T A 16: 56,169,754 L622M probably damaging Het
Sgo1 G A 17: 53,676,953 R466C probably damaging Het
Sh3tc1 C A 5: 35,706,246 V866L probably benign Het
Snrnp25 T A 11: 32,207,647 V75D probably benign Het
Syne1 C T 10: 5,061,429 C7899Y probably damaging Het
U2af1l4 T C 7: 30,564,582 S55P probably damaging Het
Vmn1r23 A G 6: 57,926,055 I246T possibly damaging Het
Vmn1r66 T A 7: 10,274,402 R235* probably null Het
Wnk4 C T 11: 101,275,068 A807V possibly damaging Het
Other mutations in Fam122a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Fam122a APN 19 24476632 missense probably damaging 1.00
IGL01662:Fam122a APN 19 24476584 missense probably benign 0.00
IGL03070:Fam122a APN 19 24476952 missense probably damaging 1.00
R4032:Fam122a UTSW 19 24476742 missense probably benign 0.08
R7301:Fam122a UTSW 19 24477124 missense probably benign 0.00
R7301:Fam122a UTSW 19 24477346 missense probably damaging 1.00
R7940:Fam122a UTSW 19 24477188 missense probably benign 0.41
Z1177:Fam122a UTSW 19 24476803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAACACTGCTTCCCAATTC -3'
(R):5'- CCATGGCTCAGGAGAAGATG -3'

Sequencing Primer
(F):5'- GCTTCCCAATTCCCCGGG -3'
(R):5'- TGCGGAGGTCTAACAGCG -3'
Posted On2017-10-10