Incidental Mutation 'R6165:Catsperb'
ID490104
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Namecation channel sperm associated auxiliary subunit beta
Synonyms4932415G16Rik
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6165 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location101404653-101626009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101575816 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 592 (Y592N)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055156
AA Change: Y592N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: Y592N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221965
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
H2afy A T 13: 56,104,455 N108K probably damaging Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Maats1 A G 16: 38,333,811 F124S possibly damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Syne1 A T 10: 5,425,678 L138Q probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1449:Catsperb UTSW 12 101588197 missense probably benign 0.09
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101446068 missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6210:Catsperb UTSW 12 101412568 intron probably null
R6297:Catsperb UTSW 12 101591396 unclassified probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101481048 missense probably damaging 1.00
R7422:Catsperb UTSW 12 101588034 missense probably damaging 1.00
R7425:Catsperb UTSW 12 101591498 missense probably damaging 0.96
R7578:Catsperb UTSW 12 101588285 missense probably benign 0.01
R8021:Catsperb UTSW 12 101588063 missense probably benign 0.22
R8060:Catsperb UTSW 12 101602766 missense probably damaging 0.98
RF006:Catsperb UTSW 12 101575979 critical splice donor site probably null
Z1177:Catsperb UTSW 12 101446048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTCATGATCTCCAGCACT -3'
(R):5'- TTGAAGCCAATGGAGATAGGTT -3'

Sequencing Primer
(F):5'- TGATCTCCAGCACTAAACGATGATAG -3'
(R):5'- AACAAGGGCTGTCCTTT -3'
Posted On2017-10-10