Incidental Mutation 'R6165:H2afy'
ID490108
Institutional Source Beutler Lab
Gene Symbol H2afy
Ensembl Gene ENSMUSG00000015937
Gene NameH2A histone family, member Y
SynonymsH2AF12M, mH2a1, MACROH2A1.2, macroH2A1
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6165 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location56073619-56136361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56104455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 108 (N108K)
Ref Sequence ENSEMBL: ENSMUSP00000038221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016081] [ENSMUST00000045788]
Predicted Effect probably damaging
Transcript: ENSMUST00000016081
AA Change: N108K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016081
Gene: ENSMUSG00000015937
AA Change: N108K

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 330 2.72e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000045788
AA Change: N108K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038221
Gene: ENSMUSG00000015937
AA Change: N108K

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 327 4.88e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile and display no gross phenotypic abnormalities. Mice homozygous for a different knock-out allele exhibit female-specific hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Catsperb T A 12: 101,575,816 Y592N possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Maats1 A G 16: 38,333,811 F124S possibly damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Syne1 A T 10: 5,425,678 L138Q probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in H2afy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:H2afy APN 13 56074319 missense possibly damaging 0.75
IGL01294:H2afy APN 13 56074300 missense probably damaging 1.00
IGL02505:H2afy APN 13 56074330 missense probably damaging 1.00
IGL02994:H2afy APN 13 56104299 splice site probably benign
R0270:H2afy UTSW 13 56096114 splice site probably benign
R0988:H2afy UTSW 13 56083296 critical splice acceptor site probably null
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1638:H2afy UTSW 13 56104909 missense probably damaging 1.00
R1782:H2afy UTSW 13 56074321 missense probably damaging 0.99
R1850:H2afy UTSW 13 56096239 splice site probably benign
R1860:H2afy UTSW 13 56083204 missense probably damaging 1.00
R2228:H2afy UTSW 13 56084262 missense probably damaging 1.00
R4674:H2afy UTSW 13 56083184 missense possibly damaging 0.91
R5102:H2afy UTSW 13 56096123 critical splice donor site probably null
R5106:H2afy UTSW 13 56088293 missense possibly damaging 0.75
R5161:H2afy UTSW 13 56089781 missense probably benign 0.05
R5862:H2afy UTSW 13 56074271 missense probably damaging 1.00
R6588:H2afy UTSW 13 56104489 missense possibly damaging 0.90
R6994:H2afy UTSW 13 56089830 missense probably benign 0.11
R7669:H2afy UTSW 13 56128333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGATCCCGTACCTTAGAC -3'
(R):5'- AATTCAGACCAAGTGAGGGC -3'

Sequencing Primer
(F):5'- CGTACCTTAGACTTCCGGGC -3'
(R):5'- ACTCGAGTCCCATGTGGTAG -3'
Posted On2017-10-10