Mutagenetix > Incidental Mutations

Incidental Mutation 'R6165:Mroh2b'

490111

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

044311-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R6165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4918350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 549 (M549K)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably benign
Transcript: ENSMUST00000045736
AA Change: M549K

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: M549K

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.1%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd35	A	G	3: 96,683,307	E303G	possibly damaging	Het
C2cd5	T	C	6: 143,050,228	T389A	possibly damaging	Het
Catsperb	T	A	12: 101,575,816	Y592N	possibly damaging	Het
Cnot9	T	C	1: 74,528,793	V280A	probably benign	Het
Cyld	A	G	8: 88,746,933	I927V	possibly damaging	Het
Etfdh	A	T	3: 79,604,944	S490T	probably benign	Het
Fam214a	A	G	9: 75,025,672	T974A	probably damaging	Het
Fance	C	T	17: 28,326,094	R150C	probably benign	Het
Far1	A	G	7: 113,554,218	K353E	probably benign	Het
Fbn1	T	C	2: 125,332,363	I1858V	probably damaging	Het
Frem1	T	C	4: 82,956,255	K1359E	probably benign	Het
Ghdc	T	G	11: 100,769,102	E273A	possibly damaging	Het
Gpt	A	G	15: 76,697,970	D209G	probably benign	Het
H2afy	A	T	13: 56,104,455	N108K	probably damaging	Het
Hspb7	T	C	4: 141,422,551	F83L	probably benign	Het
Itga7	A	G	10: 128,942,935	I306M	probably benign	Het
Itgb5	A	G	16: 33,899,242	E261G	probably benign	Het
Kcnj14	G	T	7: 45,820,000	A27E	possibly damaging	Het
Kif13b	A	G	14: 64,742,311	H470R	probably damaging	Het
Maats1	A	G	16: 38,333,811	F124S	possibly damaging	Het
Morc3	T	C	16: 93,841,383	F18L	probably damaging	Het
Mrgprb8	T	A	7: 48,388,817	C79S	possibly damaging	Het
Msl1	T	C	11: 98,804,847	V563A	probably damaging	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr1489	A	T	19: 13,633,143	I11F	possibly damaging	Het
Olfr1489	C	T	19: 13,633,588	A159V	probably benign	Het
Phf2	C	A	13: 48,813,865		probably null	Het
Pjvk	T	G	2: 76,650,218		probably null	Het
Rgl2	A	G	17: 33,931,765	T66A	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Rtkn	G	T	6: 83,145,963	E67D	probably damaging	Het
Serpinb9	T	A	13: 33,008,824	F121L	possibly damaging	Het
Slc17a2	G	A	13: 23,815,070	V149I	probably benign	Het
Sobp	A	G	10: 43,022,603	S329P	probably damaging	Het
Syne1	A	T	10: 5,425,678	L138Q	probably damaging	Het
Tfr2	T	A	5: 137,580,257	V449D	probably damaging	Het
Tmem151b	T	C	17: 45,545,785	Y243C	probably damaging	Het
Trank1	T	C	9: 111,391,872	V2559A	probably benign	Het
Trim35	T	C	14: 66,309,205	Y474H	probably damaging	Het
Uso1	A	T	5: 92,187,267	L495F	probably damaging	Het
Wdr24	A	G	17: 25,826,421	I377V	probably benign	Het
Xpo5	T	A	17: 46,235,957	V878D	possibly damaging	Het
Zfc3h1	A	G	10: 115,420,669	I1515V	probably benign	Het
Zfp319	CA	C	8: 95,328,105	489	probably null	Het
Zfp384	T	G	6: 125,024,933		probably null	Het
Zfp704	G	T	3: 9,443,886	P416T	probably benign	Het
Zfr	C	T	15: 12,146,245	A294V	unknown	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGCCCTTTACACACATTC -3'
(R):5'- CTCATAAAGCTGCCATTCTGAC -3'

Sequencing Primer
(F):5'- TACACACATTCTCACTTGACCATC -3'
(R):5'- CCATTCTGACCTGTTGAGAGCTAG -3'

Posted On

2017-10-10