Incidental Mutation 'R6165:Maats1'
ID490115
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6165 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38333811 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 124 (F124S)
Ref Sequence ENSEMBL: ENSMUSP00000110388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023501
AA Change: F124S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: F124S

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114740
AA Change: F124S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: F124S

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141896
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Catsperb T A 12: 101,575,816 Y592N possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
H2afy A T 13: 56,104,455 N108K probably damaging Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Syne1 A T 10: 5,425,678 L138Q probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4280001:Maats1 UTSW 16 38332773 missense probably benign 0.23
PIT4449001:Maats1 UTSW 16 38328358 missense probably damaging 1.00
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1693:Maats1 UTSW 16 38341723 missense probably benign
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4493:Maats1 UTSW 16 38341768 missense probably benign 0.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7271:Maats1 UTSW 16 38328346 missense probably damaging 1.00
R7325:Maats1 UTSW 16 38321601 intron probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGCACCCTTTGTTGCCATG -3'
(R):5'- AATGTTGTGTCCCAGACAGG -3'

Sequencing Primer
(F):5'- ACCCTCTGTGATATGTCTGTTG -3'
(R):5'- CTCTGCTATTTTCATTAAGAGTGGC -3'
Posted On2017-10-10