Incidental Mutation 'R6165:Tmem151b'
ID490120
Institutional Source Beutler Lab
Gene Symbol Tmem151b
Ensembl Gene ENSMUSG00000096847
Gene Nametransmembrane protein 151B
SynonymsLOC210573
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6165 (G1)
Quality Score94.0077
Status Validated
Chromosome17
Chromosomal Location45541940-45549677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45545785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 243 (Y243C)
Ref Sequence ENSEMBL: ENSMUSP00000136337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113547] [ENSMUST00000180252]
Predicted Effect probably benign
Transcript: ENSMUST00000113547
SMART Domains Protein: ENSMUSP00000109175
Gene: ENSMUSG00000023949

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
Blast:LRR 235 274 7e-14 BLAST
LRR 304 331 5.02e-6 SMART
LRR 332 358 1.28e-3 SMART
LRR 359 386 5.81e-2 SMART
LRR 387 414 2.05e-2 SMART
LRR 415 442 1.13e-4 SMART
Blast:LRR 443 470 3e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180252
AA Change: Y243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136337
Gene: ENSMUSG00000096847
AA Change: Y243C

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:TMEM151 40 486 2e-213 PFAM
low complexity region 511 518 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Catsperb T A 12: 101,575,816 Y592N possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
H2afy A T 13: 56,104,455 N108K probably damaging Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Maats1 A G 16: 38,333,811 F124S possibly damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Syne1 A T 10: 5,425,678 L138Q probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Tmem151b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1470:Tmem151b UTSW 17 45545737 missense probably damaging 0.98
R1470:Tmem151b UTSW 17 45545737 missense probably damaging 0.98
R1668:Tmem151b UTSW 17 45545905 missense probably damaging 1.00
R1980:Tmem151b UTSW 17 45545461 missense possibly damaging 0.72
R5124:Tmem151b UTSW 17 45547119 missense probably damaging 1.00
R5247:Tmem151b UTSW 17 45545645 missense probably damaging 1.00
R5602:Tmem151b UTSW 17 45545600 missense probably damaging 1.00
R5872:Tmem151b UTSW 17 45547084 missense probably benign 0.06
R6001:Tmem151b UTSW 17 45545785 missense probably damaging 1.00
R6263:Tmem151b UTSW 17 45547066 missense probably benign 0.04
R7340:Tmem151b UTSW 17 45545269 missense probably benign 0.28
R7664:Tmem151b UTSW 17 45545935 missense probably damaging 1.00
R7684:Tmem151b UTSW 17 45547003 missense probably damaging 1.00
R7703:Tmem151b UTSW 17 45545798 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGTGATAGTGCGCATACG -3'
(R):5'- AAAAGCTGCAGTCTGCTCC -3'

Sequencing Primer
(F):5'- GGCCAGGACAGCGTGAG -3'
(R):5'- GACTCCAACTTCCTCCTGCAGG -3'
Posted On2017-10-10