Incidental Mutation 'R6166:Atg13'
ID490128
Institutional Source Beutler Lab
Gene Symbol Atg13
Ensembl Gene ENSMUSG00000027244
Gene Nameautophagy related 13
SynonymsD2Ertd391e, 1110053A20Rik
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91674618-91710576 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91676391 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 479 (Q479K)
Ref Sequence ENSEMBL: ENSMUSP00000076081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028678] [ENSMUST00000076803] [ENSMUST00000090614] [ENSMUST00000111329] [ENSMUST00000111330] [ENSMUST00000111331]
Predicted Effect probably damaging
Transcript: ENSMUST00000028678
AA Change: Q516K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028678
Gene: ENSMUSG00000027244
AA Change: Q516K

DomainStartEndE-ValueType
Pfam:ATG13 77 195 1.5e-10 PFAM
low complexity region 252 269 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076803
AA Change: Q479K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076081
Gene: ENSMUSG00000027244
AA Change: Q479K

DomainStartEndE-ValueType
Pfam:ATG13 17 195 1.1e-35 PFAM
low complexity region 386 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090614
SMART Domains Protein: ENSMUSP00000088105
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111330
SMART Domains Protein: ENSMUSP00000106962
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153631
Meta Mutation Damage Score 0.2016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an autophagy factor and a target of the TOR kinase signaling pathway. The encoded protein is essential for autophagosome formation and mitophagy. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Atg13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Atg13 APN 2 91692459 missense probably damaging 0.99
IGL00688:Atg13 APN 2 91686497 splice site probably benign
IGL01106:Atg13 APN 2 91695952 missense probably damaging 1.00
IGL01309:Atg13 APN 2 91678831 missense possibly damaging 0.80
IGL03213:Atg13 APN 2 91685167 missense probably damaging 0.96
neodwarf UTSW 2 91684765 splice site probably null
R0201:Atg13 UTSW 2 91684762 splice site probably null
R0571:Atg13 UTSW 2 91678718 splice site probably benign
R0606:Atg13 UTSW 2 91682073 missense probably benign
R1445:Atg13 UTSW 2 91679990 missense probably damaging 0.99
R2281:Atg13 UTSW 2 91679425 missense probably benign 0.17
R4739:Atg13 UTSW 2 91684695 missense probably damaging 1.00
R5356:Atg13 UTSW 2 91692466 nonsense probably null
R5434:Atg13 UTSW 2 91684765 splice site probably null
R6891:Atg13 UTSW 2 91685791 missense probably benign 0.42
R7126:Atg13 UTSW 2 91680420 missense probably damaging 0.99
R7571:Atg13 UTSW 2 91680342 critical splice donor site probably null
R7647:Atg13 UTSW 2 91688661 missense possibly damaging 0.93
R7767:Atg13 UTSW 2 91679366 missense probably damaging 1.00
R8252:Atg13 UTSW 2 91680354 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTGTTACAGCCAGCTTCCAG -3'
(R):5'- GTTAGTTTGCCTGGCACTGC -3'

Sequencing Primer
(F):5'- CTGACTGCTGCCATGAGTC -3'
(R):5'- GCACTGCCCAGTTCCTG -3'
Posted On2017-10-10